awae143-html.html

reserved. For commercia l re-use, plea se conta ct reprints@oup.com for reprints a nd tra nsla tion rights for

reprints. All other permissions ca n be obta ined through our RightsLink service via the Permissions link on the

a rticle pa ge on our site—for further informa tion plea se conta ct journa ls.permissions@oup.com. This a rticle is

published a nd distributed under the terms of the Oxford University Press, Sta n da rd Journa ls Publica tion Model

(https://aca demic.oup.com/pa ges/sta nda rd-publica tion-reuse-rights)

Hippocampal excitation-inhibition balance underlies the

5-HT

receptor in modulating depressive behaviours

Hu-Jiang Shi,

1,2,†

Yi-Ren Xue,

1,†

Hua Shao,

1,†

Cheng Wei,

3,†

Ting Liu,

Jie He,

Yu-Hao

Yang,

Hong-Mei Wang,

Na Li,

Si-Qiang Ren,

Lei Chang,

Zhen Wang

and Li-Juan Zhu

1,2

†

These authors contributed equally to this work.

Abstract

The implication of 5-hydroxytryptamine 2C receptor (5-HT

R) in depression is a topic of

debate, and the underlying mechanisms remain largely unclear. We now elucidate

hippocampal excitation-inhibition (E/I) balance underlies the regulatory effects of 5-HT

in depression.

Molecular biological analyses showed that chronic mild stress (CMS) reduced the expression

of 5-HT

R in hippocampus. We revealed that inhibition of 5-HT

R induced depressive-like

behaviors, reduced GABA release and shifted the E/I balance toward s excitation in CA3

pyramidal neurons by using behavioral analyses, microdialysis coupled with mass spectrum,

and electrophysiological recording. Moreover, 5-HT

R modulated neuronal nitric oxide

synthase (nNOS)-carboxy-terminal PDZ ligand of nNOS (CAPON) interaction through

influencing intracellular Ca

release, as determined by fiber photometry and

coimmunoprecipitation. Notably, disruption of nNOS-CAPON by specific small molecule

compound ZLc-002 or AAV-CMV-CAPON-125C-GFP, abolished 5-HT

R inhibition-

induced depressive-like behaviors, as well as the impairment in soluble N-ethylmaleimide-

sensitive factor attachment protein receptor (SNARE) complex assembly-mediated GABA

vesicle release and a consequent E/I imbalance. Importantly, optogenetic inhibition of CA3

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

GABAergic neurons prevented the effects of AAV-CMV-CAPON-125C-GFP on depressive

behaviors in the presence of 5-HT

R antagonist.

Conclusively, our findings disclose the regulatory role of 5-HT

R in depressive-like

behaviors and highlight the hippocampal nNOS-CAPON coupling-triggered E/I imbalance as

a pivotal cellular event underpinning the behavioral consequences of 5-HT

R inhibition.

Author affiliations:

1 Key Laboratory of Developmental Genes and Human Diseases, MOE, Department of

Histology and Embryology, Department of Pharmacy, Zhongda Hospital, School of

Medicine, Southeast University, Nanjing, Jiangsu, 210009, China

2 Shanghai Mental Health Center, Shanghai Jiao Tong University School of Medicine,

Shanghai, 201108, China

3 Guangdong-Hong Kong-Macao Greater Bay Area Center for Brain Science and Brain-

Inspired Intelligence; Key Laboratory of Mental Health of the Ministry of Education;

Guangdong Province Key Laboratory of Psychiatric Disorders, Southern Medical University,

Guangzhou, 510515, Guangdong, China

4 Department of Pharmacology, School of Pharmacy, Nanjing Medical University, Nanjing,

Jiangsu, 210009, China

Correspondence to: Li-Juan Zhu

Key Laboratory of Developmental Genes and Human Diseases, MOE, Department of

Histology and Embryology, Department of Pharmacy, Zhongda Hospital, School of

Medicine, Southeast University, Nanjing, Jiangsu, 210009, China

E-mail: zhulj@seu.edu.cn

Correspondence may also be addressed to: Zhen Wang

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

Shanghai Mental Health Center, Shanghai Jiao Tong University School of Medicine,

Shanghai, 201108, China

E-mail: wangzhen@smhc.org.cn

Running title

: 5-HT

R regulated E/I balance in depression

Keywords:

5-HT

receptor; depression; excitation-inhibition balance; neurotransmitter

release; nNOS-CAPON coupling

Introduction

According to the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2019,

depressive disorder is one of the most disabling mental disorders, with ranking among top 25

leading causes of global burden of disease.

Moreover, the COVID-19 pandemic in 2020 has

led to a 27.6% increase in the prevalence of depression,

further increasing the economic and

social burden on society. Unfortunately, the understanding of the pathophysiological

mechanisms underlying the depressive disorder remains elusive; meanwhile there is currently

lack of effective and safe drugs in clinic. Since the proposal of the serotonin hypothesis of

depression, abnormal serotonergic signalling has been considered as a risk factor for the

pathogenesis of depressive disorder.

Among the numerous serotonin (5-hydroxytryptamine,

5-HT) receptors, the involvement of 5-HT

receptor (5-HT

R) in depression is of great

interest.

A majority of the literature about 5-HT

R in depression extends from the investigations in

the postmortem brains of patients with major depressive disorder and the animal researches.

Clinical discoveries have revealed the down-regulated

HTR2C

expression within the brains of

patients with depression.

5,6

Moreover, a notable increase of the dysfunctional 5-HT

isoforms generated by pre-mRNA editing, which could reduce receptor activity primarily

through diminishing both agonist potency and G-protein coupling activity, has been observed

in the brains of depressed suicide individuals.

However, there are also studies reported the

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

inconsistent findings, such as increased

HTR2C

expression in the frontal cortex of suicidal

individuals or unchanged 5-HT

R pre-mRNA editing in the frontal cortex of individuals

with major depression.

5,7

Animal studies have also demonstrated inconsistent findings

regarding the role of 5-HT

R in depressive behaviors when using its agonists or

antagonists.

Although these findings evidence a close association between 5-HT

R and

depressive disorder, the precise effect and underlying mechanisms of 5-HT

R in the

modulation of depressive behaviors remain to be elucidated.

Extensive studies have emphasized the importance of the excitation-inhibition (E/I)

balance, orchestrated by the neurotransmitters glutamate and GABA in maintaining the

normal function of the brain.

Disruption of the E/I balance is thought to be a pivotal

pathological basis of depressive disorder.

Studies have shown that 5-HT regulates E/I

balance in cortical pyramidal neurons, with different modulation observed across various

subtypes of 5-HT receptors.

9,10

Notably, the blockade of 5-HT

receptors produced the

opposite effects on the E/I balance of cortical pyramidal neurons in layer 2/3 and layer 6,

respectively. Conversely, blocking 5-HT

receptors led to a shift of the E/I balance toward

excitation in layer 2/3.

Additionally, there is study reported that optogenetic activation of 5-

R-coupled G

signals in GABAergic neurons in dorsal raphe nucleus (DRN) reduced

local serotonergic firing and alleviated the anxiety-like behaviors.

However, the effect and

underlying mechanisms of 5-HT

R on hippocampal E/I balance are unknown.

Evidence indicated that the abnormal vesicle release of GABA and glutamate is implicated

in E/I imbalance.

Soluble N-ethylmaleimide-sensitive factor attachment protein receptor

(SNARE) complex, formed by the assembly of v-SNARE (synaptobrevin/VAMP) on

synaptic vesicles and t-SNARE (syntaxin 1 and SNAP-25) on the presynaptic membrane, is

crucial in synaptic vesicle fusion and neurotransmitter exocytosis.

Therefore, we here

sought to explore whether 5-HT

R regulates the E/I balance by affecting the SNARE

assembly-mediated neurotransmitter release.

Notably, we recently reported that hippocampal neuronal nitric oxide synthase (nNOS)-

carboxy-terminal PDZ ligand of nNOS (CAPON) association mediates synaptogenic and

anxiety-behaviors.

13-15

Here, we confirmed that 5-HT

R modulates the hippocampal nNOS-

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

CAPON coupling via affecting intracellular Ca

release. Additionally, we also investigated

whether nNOS-CAPON coupling is involved in 5-HT

R-modulated SNARE assembly-

mediated neurotransmitters vesicle release and E/I balance, as well as depressive-like

behaviors. Collectively, our findings identify that hippocampal nNOS-CAPON coupling

induced-E/I imbalance underlies the behavioral consequences of 5-HT

R inhibition.

Materials and methods

Animals

Young adult C57BL/6J male mice (6 weeks, 18-22g) (RRID: IMSR_JAX:000664, from the

GemPharmatech Co., Ltd., Jiangsu, China) and ICR male mice (6–7 weeks, 22-26g) (RRID:

MGI:2160272, from Shanghai SLAC Laboratory Animal Co., Ltd., Shanghai, China) were

housed in a 12 h light/dark cycle with access to food and water

ad libitum

. ICR male mice

were used for chronic mild stress (CMS) model. All procedures involving the use of animals

were approved by the Institutional Animal Care and Use Committee of Southeast University

(IACUC-20210307011).

Drugs

5-HT

R antagonist SB242084 (Cat# HY-13409A), RS-102221 (Cat# HY-101365A) and

agonist CP809101 (Cat# HY-15543A), Calcimycin (A-23187, Cat# HY-N6687) and

Xestospongin C (Cat# HY-103312) were purchased from MedChemExpress (New Jersey,

USA) and were dissolved in saline. ZLc-002, a small molecular inhibitor of nNOS-CAPON

interaction, was designed and synthesized in our laboratory.

SB242084 (1 mg/kg), RS-

102221 (2 mg/kg) and CP809101 (1 mg/kg) were injected into mice intraperitoneally. ZLc-

002 (10 µM), A-23187 (5 µM) and Xestospongin C (5 µM) were delivered into the

hippocampus of mice by microinjection as described previously.

14,15

Tamoxifen (75 mg/kg,

Cat# T5648, Sigma Aldrich, Missouri, USA) was given as a solution in corn oil (Cat#

C116023, Aladdin, Shanghai, China) to mice intraperitoneally for 7 consecutive days.

Virus vectors, surgery and intrahippocampal injection

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

Adeno-associated virus (AAV)-cytomegalovirus (CMV)-CAPON-125C-GFP-3Flag (1 μl,

titer 2.14×10

vg/ml) was generated by GeneChem Co, Ltd (Shanghai, China). The rAAV-

EF1a-DIO-TeNT(tettoxlc)-P2A-EGFP-WPREs (PT-2434, 300 nl, titer 5.94×10

vg/ml),

rAAV-hsyn-creERT2-WPRE-hGH pA (PT-1868, 300 nl, titer 5.00×10

vg/ml), rAAV-mDLx-

eNpHR3.0-EYFP-WPRE-hGH pA (PT-0337, 200 nl, titer 5.87×10

vg/ml) and rAAV-hsyn-

GCaMP6s-WPRE-hGH pA (PT-0145, 300 nl, titer 5.27×10

vg/ml) were purchased from

BrainVTA Co, Ltd (Wuhan, China).

Surgeries were performed as previously described.

13,14,16

Briefly, the animals were placed

in the stereotaxic instrument (Cat# 68030, RWD Life Science, Shenzhen, China) and kept

anesthetized with isoflurane (1%) during virus injection. The skull above the targeted areas

was opened with a dental drill carefully. Injections were performed via Hamilton syringe

(Cat# 87925, Hamilton, Germany) connected to a syringe pump (Cat# 78-3180, LEGATO

130, KD Scientific, USA). The virus was directly delivered into the hippocampal DG (AP:

−2.3 mm; ML: ±1.4 mm; DV: −2.0 mm) or CA3 (AP: −2.3 mm; ML: ±2.6 mm; DV: −2.5

mm) at a rate of 50 nl/min. The bilateral guide cannulas (O.D. 0.48 mm × I.D. 0.34

mm/M3.5, C = 2.0 mm, Cat# 62003; O.D. 0.3 mm/M3.5, G = 0, Cat# 62102, RWD Life

Science) for intrahippocampal infusion and , optical fibers (O.D. 200 μm, NA = 0.37; length

2.0 mm, Inper, Hangzhou, China) for fiber photometry recordings were implanted above the

DG (AP: −2.3 mm; ML: ±1.4 mm; DV: −1.8 mm), and optical fibers (O.D. 200 μm, NA =

0.37; length 2.0 mm, Inper, Hangzhou, China) for optogenetic inhibition were implanted

above the CA3 (AP: −2.3 mm; ML: ±2.6 mm; DV: −2.1 mm). The cannulas and optical fibers

were secured to the skull using dental cement.

Chronic mild stress and behavioral tests

The CMS procedure and behavioral tests were performed as described in our previous

studies.

13,14,17

In detail, the open field test (OFT) was performed in a square chamber (40×40 cm), and

each mouse was allowed to move freely for 30 min. The movement of the mice was recorded

using a digital camera and the total locomotor activity was analyzed with EthoVision 11.5

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

(Noldus). The tail suspension test (TST) was conducted by suspending the mice on a station

(60 cm above the floor) for 6 min. After 1 min of acclimatization, the performance of the

mice was recorded by a camera for 6 min and the total immobility time was analyzed using

PhenoScan Series (Clever Syn. Inc). The forced swim test (FST) was performed by placing

mice into a clear glass cylinder (height 20 cm, diameter 17 cm) containing water at a depth of

10 cm (23-25 °C) and recorded for 5 min. The total immobility time was analyzed using

PhenoScan Series (Clever Syn. Inc). The sucrose preference test (SPT) was performed as

follow: mice were initially habituated to drinking water and 1% sucrose solution for two

days, followed with deprivation of water for 24 h. The mice were then given free access to a

two-bottle choice of drinking water or 1% sucrose solution in the dark phase for 12 h. Total

consumption of each solution was measured and sucrose preference rate was calculated as:

consumption of sucrose ×100%/total consumption of sucrose and water.

The behavioral tests were performed during the dark phase of the light/dark cycle (18:00 to

23:00), and the plate was cleaned with 70% ethyl alcohol (EtOH) after each trail. The

investigators were blinded to the treatment group during the experiments and analysis.

Western blot analysis

Western blot analysis was performed as described previously.

Briefly, the hippocampal

tissues were quickly removed from mice on the ice and then lysed with RIPA (Cat# P0013C,

Beyotime Biotechnology, Shanghai, China). The sample proteins were determined the

concentrations with the BCA Protein Assay Kit (Cat#23227, Thermo Fisher Scientific,

Massachusetts, USA), followed by loading on 10% SDS-PAGE gels for electrophoresis, and

then transferred to the PVDF membrane (Cat# IPVH00010, Millipore Bioscience Research

Reagents, California, USA). The membranes were incubated with primary antibodies

overnight at 4 °C after blocking with 5% skimmed milk. The primary antibodies used were as

follows: rabbit anti-5-HT2CR (1:2000; Cat# sc-17797, RRID: AB_628241, Santa Cruz

Biotechnology, Texas, USA), rabbit anti-nNOS (1:2000; Cat# AB5380, RRID: AB_91824,

Millipore Bioscience Research Reagents), rabbit anti-CAPON (1:10000; Cat# ab190686,

RRID: AB_2713895, Abcam, MA, USA), mouse anti-SNAP25 antibody (1:20000, Cat#

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

111011, RRID: AB_887794, Synaptic Systems, Gottingen, Germany), mouse anti-Syntaxin

1A antibody (1:10000, Cat# 110111, RRID: AB_887848, Synaptic Systems), mouse anti-

VAMP2 antibody (1:10000, Cat# 104211, RRID: AB_887811, Synaptic Systems), rabbit anti-

β-actin antibody (1:40000; Cat# ab8227, RRID: AB_2305186, Abcam). Horseradish

peroxidase-linked secondary antibodies (Cat# GAR007, RRID: AB_2827833; Cat#

GAM0072, RRID: AB_2827834, MultiSicences, Zhejiang, China) were used for detection by

enhanced chemiluminescence (Cat# 34577, Thermo Fisher Scientific). In statistical analysis,

chemifluorescence was detected by Tanon-5200 Imaging system (Tanon Science &

Technology, Shanghai, China).

Coimmunoprecipitation (CO-IP)

The CO-IP assay was performed as described previously,

13,15,18

with minor modifications.

The hippocampal tissues were lysed with lysis buffer A (Cat# R0278; Sigma-Aldrich) and

then centrifuged to obtain the protein supernatants. The supernatants were pre-incubated with

mouse anti-nNOS antibody (1:50; Cat# 610308, RRID: AB_397700, 5 μg, BD Transduction

Laboratories, NJ) overnight, and then incubated with protein G-Sepharose beads (Cat#

P7700; Sigma-Aldrich) for another 6 h at 4 °C. The complexes were centrifuged at 5000 × g

and washed with PBS for 5 times to remove proteins that adhered non-specifically to the

beads, and then boiled in loading buffer at 100 °C to elute the bounded proteins. The analysis

was conducted by western blot.

Isolation of synaptosomes and SNARE complex detection

Synaptosomes were prepared as described previously with some modifications.

13,19

The

hippocampal tissues were rapidly removed and lysed in prepared lysis buffer (0.32 M

sucrose, 1 mM NaHCO

, 1 mM MgCl

, 0.5 mM CaCl

, 1 mM PMSF and protease inhibitors)

with Tissuelyser at 4 °C. The lysates were centrifuged at 500 × g for 2 min to collect the

supernatants, and then centrifuged at 10,100 × g for 10 min to obtain the pellets. The pellets

were re-suspended in 0.32 M sucrose, then layered onto 0.8 M sucrose. The synaptosomes

were collected from the 0.8 M sucrose fraction after centrifuging at 9100 × g for 15 min, and

then centrifuged at 12000 × g for 15 min and resuspended in SDS-lysis buffer. Synaptosomes

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

samples were boiled in loading buffer at 100 °C and then immunoblotted together with the

non-boiled samples.

The SNARE complex assembly was analyzed with reference to previous studies.

The

non-boiled SNARE complex divided by the boiled monomer represents the assembly of the

SNARE complex.

Immunofluorescence and in situ hybridization analyses

Immunofluorescence staining was performed as previously described.

Mice were perfused

with 0.9% NaCl followed by 4% paraformaldehyde, and the brains were postfixed overnight,

dehydrated in 20% and 30% sucrose, and then sectioned at 40 μm thickness using a cryostat

(CM 1950, Leica, Nubloch, Germany). The sections were blocked in 3% normal goat serum

at room temperature for 1 h, and then incubated in primary antibody at 4 °C overnight. After

rinsing three times in PBS, the sections were incubated with secondary antibody for 4 h at

room temperature. Images were captured with a confocal microscope (FV3000, Olympus,

Tokyo, Japan). The antibodies used as follow: rabbit anti-GFP (1:1000, Cat# ab291, RRID:

AB_449092, Abcam), goat anti-Rabbit Alexa-488 (1:400; Cat# 111-545-003, RRID:

AB_2338046, Jackson ImmunoResearch Laboratories, Pennsylvania, USA).

For in situ hybridization, the

HTR2C

probe was obtained by PCR amplification, and the

primer is as follow:

HTR2C

-Pst1-F1: AA CTGCAGAGACCAGAATGATGCACATGAC;

HTR2C

-Sal1-R1: GCGTCGAC GAGAGCTTGGAAGGATCTGAAA. Brain sections (30

μm) were hybridized with digoxigenin-labeled antisense RNA probes at 65°C overnight,

incubated with anti-digoxigenin-alkaline phosphatase antibody for 2 h at room temperature,

and then subjected to color development.

RNA isolation, reverse transcription, and qPCR analysis

The RNA isolation, reverse transcription, and qPCR analysis were performed as described

previously with some modifications.

The total RNA was extracted using the RNA-easy

Isolation Reagent (Cat# R701-00-AA, Vazyme, Nanjing, China). The cDNA was acquired

using the HiScript II Q Select RT SuperMix with gDNA wiper (Cat# R233-01, Vazyme).

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

qPCR reactions were performed using ChamQ SYBR qPCR Master Mix (Cat# Q331-02,

Vazyme) on a StepOne

Real-Time PCR System (Applied Biosystems, MA, USA). Relative

mRNA expression level was calibrated by the internal control GAPDH (ΔCt). The primers

for qPCR were as follows:

HTR2C

-F: CTAATTGGCCTATTGGTTTGGCA;

HTR2C

-R:

CGGGAATTGAAACAAGCGTCC;

GAPDH-F:

CAATGTGTCCGTCGTGGATCT;

GAPDH-R: GTCCTCAGTGTAGCCCAAGATG. The samples were run in three duplicates.

Fiber photometry

The experiment was conducted with fiber photometry system (Inper) as described

previously.

To record fluorescence signals, a 470 nm LED beam was reflected through a

dichroic mirror (DM), focused by a 10× objective lens, and then coupled to an optical rotary

joint. The fiber patch cable (O.D. 200 μm, NA = 0.37; length 2 m) guided the light between

the rotary joint and the implanted optical fiber. The LED power at the tip of the optical fiber

was adjusted to 10-20 μW to get better excitation effect. The GCaMP fluorescence was

collected by the fiber, and then bandpass-filtered and detected by the photomultiplier tube

(PMT). An amplifier converted the PMT current output to a voltage signal, which was further

filtered through a low-pass filter (40 Hz cut-off). The analog voltage signal was finally

analyzed with Inper Data Process software (Inper Studio).

Optogenetic manipulations

The

optogenetic inhibition was performed as described previously.

The optical fibers (O.D.

200 μm, NA = 0.37, outer diameter of 1.25 mm) were connected to the smart light source

(InperB1-589) through fiber-optic rotary joint and the other end of the optical fibers

connected to the fiber optic cannula pre-implanted in hippocampal CA3. The power at the

fiber tip was 3-5 mW. During the behavioral assays, the yellow laser was turned on to deliver

the light through the optic fibers until the end of tests.

Microdialysis

Microdialysis was performed as described previously with some modifications.

Mice were

fixed on a stereotaxic instrument (Cat# 68030, RWD Life Science) after being anesthetized

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

with isoflurane (1%). A guide cannula (CMA/7, CMA, Stockholm, Sweden) was positioned

and inserted into the left hippocampal CA3 (AP: −2.3 mm; ML: ±2.6 mm; DV: −2.3 mm) and

fixed using dental cement. The microdialysis probe (CMA/7 membrane length 2 mm,

P000083, CMA) was connected to a 1 ml microsyringe controlled by a syringe pump (Cat#

78-3180, LEGATO 130, KD Scientific) with polyethylene, and inserted into the brain through

the guide cannula. The ACSF (151.1 mM Na

, 2.6 mM K

, 0.9 mM Mg

, 1.3 mM Ca

122.7 mM Cl

−

, 21.0 mM HCO

−

, 2.5 mM HPO

2−

, and 3.87 mM glucose) prewarmed to 37

°C was perfused through the probe at a rate of 1.5 μl/min. The samples were collected for

neurotransmitter analysis with mass spectrometry.

UPLC-MS/MS

The ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS)

was performed for the measurement of neurotransmitters levels as described previously with

some modifications.

A total 75 μl of brain dialysate was transferred to sample bottle and 4

μl was injected into the UPLC-MS/MS (LC-30AD, Shimadzu, Japan; AB SCIEX 3200

QTRAP®, AB SCIEX, Connecticut, USA) for targeted assay. Chromatographic separation

was performed on an Ultimate Polar column (3.0 mm ×100 mm, 3 μm) with gradient elution

using acetonitrile/0.2% formic acid-5 mM NH

Ac as mobile phases with a flow rate at 0.4

ml/min, and column temperature of 40°C. The eluate was detected by multiple-reaction

monitorings (MRMs) canning with an electrospray ionization source operating in the positive

ionization mode with an analysis duration of 8 min. The mass spectrometer conditions were

as follows: Ion source spray voltage 5.5 kV; Ion source gas curtain gas 241.3 kPa; Collision

gas 48.3 kPa; Ion source temperature 500 C; Atomized gas 413.7 kPa; Auxiliary gas 413.7

kPa. The collision energy (CE) and declustering potential (DP) were also optimized for the

corresponding target compound.

Electrophysiological recording

The electrophysiological recording was performed as described previously with minor

modifications.

Mice were decapitated after being anesthetized, then the brain was placed in

Vibroslice (VT 1200S, Leica) to prepare coronal hippocampus slices (300 μm) in ice-cold

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

Artificial Cerebral Spinal Fluid (ACSF). The ACSF (in mM) contains: 195 mM sucrose, 2.0

mM KCl, 0.2 mM CaCl

, 12 mM MgSO

, 1.3 mM NaH

, 26 mM NaHCO

, and 10 mM

glucose. The slices were incubated for 1 h at 34°C with ACSF saturated with a 95%:5%

mixture of O

: CO

. After incubation, brain slices were shifted to the recording chamber,

which was continuously perfused (3 ml/min) with recording ACSF at 32–34 °C. The

recording ACSF (in mM) contains: 126 mM NaCl, 3.0 mM KCl, 1.25 mM NaH

·H

2.0 mM CaCl

·H

O, 1.0 mM MgSO

, 26 mM NaHCO

, and 10 mM glucose. For the whole-

cell recording, the pipettes were filled with internal solution containing (in mM): 126 mM K -

gluconate, 2.0 mM KCl, 10 mM HEPES, 2.0 mM MgCl

, 4.0 mM Na

-ATP, 0.4 mM Na

GTP, 10 mM phosphocreatine (pH = 7.25). The sEPSCs were recorded with a voltage clamp

at –70 mV while the sIPSCs were measured at 0 mV. All recordings were performed with

conventional patch-clamp amplifiers EPC10 (HEKA, Germany) and analyzed with a Clamp-

fit 10.7 (Molecular Devices, CA). All data were collected when the series resistance in the

initial values (20–30 MΩ), sampled in 10 kHz and filtered in 1 kHz.

To confirm the functionality of expressed eNpHR3.0, the GFP

interneurons in CA3 were

visualized under an upright microscope and selected for whole-cell voltage-clamp recordings.

The patch electrodes (4-6 MΩ) were made from borosilicate glass using a micropipette puller

(Model P-1000; Sutter Instruments), and the electrodes were filled with solution composed of

(in mM) 132.5 Cs-gluconate, 17.5 mM CsCl, 2 mM MgCl

, 0.5 mM EGTA, 10 mM HEPES,

4 mM ATP, 5 mM QX-314 (pH 7.3). To obtain light-evoked responses, the yellow light (594

nm, 1 s, 1 Hz, to activate eNpHR3.0) was delivered through an optical fiber (200 µm, NA

0.37) connected to a PlexBright LED light source (Plexon Inc, Hong Kong, China).

Statistical analysis

All results are shown as means ± SEM. The normality of the data was assessed with Shapiro-

Wilk test. If the data was normally distributed, the two-tailed, unpaired, Student’s

test or

one-way ANOVA or two-way ANOVA with Tukey's multiple comparisons test was used for

group comparisons (if significant variance heterogeneity was found in the data, then two-

tailed, unpaired

test with Welch’s correction or Welch ANOVA with Dunnett's T3 multiple

comparisons test was carried out). If the data was not normally distributed, the two-tailed

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

Mann-Whitney test or Kruskal-Wallis ANOVA with Dunn's multiple comparisons test was

used for group comparisons. GraphPad Prism 8.3.0 (Graph Pad Software, Inc., USA) was

used for statistical analyses. The p-value of < 0.05 was considered statistically significant.

Results

5-HT

R participates in the modulation of hippocampal E/I

balance and depressive behaviors

To investigate the distribution of 5-HT

R in the brain, we initially conducted an analysis

using

the

data

obtained

from

the

Human

Protein

Atlas

database

(https://www.proteinatlas.org/), and subsequently validated through in situ hybridization

staining, and revealed that

HTR2C

was widely expressed in cerebral cortex, amygdala,

hippocampus and other brain regions (Supplementary Fig. 1A-E). Notably, we observed that

the distribution pattern of

HTR2C

in hippocampus, as revealed by in situ hybridization

staining, exhibited some different from that in database analysis (Supplementary Fig. 1B and

E). In particular, we found that

HTR2C

was markedly enriched in the dentate gyrus (DG) and

CA1 subregions of the hippocampus, with relatively lower labeling of the CA3 and

subiculum subregions (Supplementary Fig. 1E). Furthermore, the database analysis

demonstrated that

HTR2C

was predominantly presented in the inhibitory and excitatory

neurons (Supplementary Fig. 1C), implying its potential role in influencing neuronal

function.

Chronic stress represents a prominent contributor to mental health problems such as

depression. Here, we performed differential expression gene analysis on RNA sequencing

(RNA-seq)

data

obtained

from

GEO

cohort

(GSE151807,

https://www.ncbi.nlm.nih.gov/geo/), and revealed notable alterations in the genes expression

of diverse 5-HT receptors in various brain regions, including the cerebral cortex, amygdala,

prefrontal cortex (PFC), and hippocampus of mice that exposed to CMS, with

HTR2C

exhibiting a significant down-regulation (Fig. 1A and Supplementary Fig. 1F-H). To further

confirm the effect of chronic stress on 5-HT

R, we constructed the CMS model of

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

depression, and demonstrated that CMS exposure significantly down-regulated the mRNA

and protein levels of 5-HT

R in the hippocampus (Fig. 1B and C). Collectively, these results

suggest a potential association between hippocampal 5-HT

R and chronic stress-related

depressive behaviors.

To verify the involvement of 5-HT

R in the regulation of depressive behaviors, we treated

the mice with 5-HT

R antagonist SB242084 (1 mg/kg, i.p.) or agonist CP809101 (1 mg/kg,

i.p.). The behavioral assessments showed that treatment with SB242084 for 2 h significantly

increased the immobility time in both the TST and FST (Fig. 1D), indicating that inhibition of

5-HT

R induces depressive-like behaviors in mice. Not surprisingly, 5-HT

R agonist

CP809101 administrated for 2 h produced antidepressant-like effects in mice, which were

characterized by the reduced immobility time in TST and FST (Fig. 1E). These results

implicate 5-HT

R in the modulation of depressive behaviors.

To investigate the effect of 5-HT

R on neuronal signal transmission, we first performed

the microdialysis coupled with targeted ultra-performance liquid chromatography-tandem

mass spectrometry (UPLC-MS/MS) to measure the extracellular levels of neurotransmitters

in the hippocampal CA3 subregion of mice treated with SB242084 intraperitoneally (Fig. 1F

and Supplementary Fig. 2 and Supplementary Table 1). The results showed that 5-HT

inhibition obviously reduced the GABA level, along with a decreasing tendency in glutamate

level in CA3 (Fig. 1G-H). Notably, SB242084 markedly increased the ratio of glutamate to

GABA (Glu/GABA) (Fig. 1I), which is known as an index of the E/I balance.

Furthermore,

we performed whole-cell recordings to measure the spontaneous inhibitory postsynaptic

currents (sIPSCs) from individual CA3 pyramidal neurons in acute slices (Fig. 1J), and found

that SB242084 led to a significant reduction in the frequency of sIPSCs and an observable

decreasing tendency in the amplitude of sIPSCs (Fig. 1K and L). In addition, we also

measured the spontaneous excitatory postsynaptic currents (sEPSCs), but found that

SB242084 had no effect on the frequency or amplitudes of sEPSCs (Fig. 1K and M). Of

particular significance, our investigation unveiled a marked increase in the sEPSCs/sIPSCs

frequency ratio, rather than amplitude ratio, following SB242084 administration (Fig. 1N),

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

which suggested that 5-HT

R inhibition shifts the E/I balance toward s excitation in

hippocampal CA3 pyramidal neurons.

To explore the effect of 5-HT

R on E/I balance of CA3 pyramidal neurons in depressed

mice, we performed whole-cell recordings to measure the sIPSCs and sEPSCs from

individual CA3 pyramidal neurons in acute slices of CMS-treated mice after CP809101

perfusion for 1h (Supplementary Fig. 3A). Consistent with previous studies,

26,27

our results

showed that CMS reduced the frequency of sIPSCs, along with a decreasing tendency in

sEPSCs (Supplementary Fig. 3B-D). Importantly, CP809101 eliminated the effects of CMS

on sIPSCs frequency and sEPSCs/sIPSCs frequency ratio (Supplementary Fig. 3C-F).

However, neither the amplitudes of sIPSCs nor sEPSCs were significantly changed after

CMS exposure or CP809101 perfusion (Supplementary Fig. 3B-D).

Collectively, our results indicate that 5-HT

R inhibition disrupts the E/I balance of

hippocampal CA3 neurons, and then giving rise to depressive-like behaviors, however, the

underlying mechanisms remain unclear.

-modulated hippocampal nNOS-CAPON coupling mediates

the behavioral consequences of 5-HT

Our previous studies have shown that 5-HT diminishes the association of nNOS with its

adaptor CAPON in the hippocampus.

Herein, we performed CO-IP experiment to measure

the levels of the nNOS-CAPON complex in the hippocampus of mice treated with 5-HT

antagonist SB242084 (1 mg/kg, i.p.) or agonist CP809101 (1 mg/kg, i.p.) for 2 h to determine

whether 5-HT

R affects the interaction between nNOS and CAPON. The results showed that

SB242084 treatment markedly increased the amounts of nNOS-CAPON complex, whereas

CP809101 attenuated the binding of nNOS-CAPON (Fig. 2A). Consistent with our previous

studies

13,15

, we observed a significant increase in hippocampal nNOS-CAPON coupling

after CMS exposure. Intriguingly, we found that CP809101 reversed the CMS-induced

nNOS-CAPON coupling (Fig. 2B).

To investigate the potential mechanism of 5-HT

R in nNOS-CAPON interaction, we

performed gene ontology (GO) functional enrichment analysis on distinct 5-HT receptor

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

subtypes identified in Figure 1, revealing the associations of

HTR2C

with the Ca

signalling

pathway, cAMP signalling pathway, gap junction, and serotonergic synapse (Fig. 2C). To

further confirm the effects of 5-HT

R on intracellular Ca

signals, we infused AAV-hSyn-

GCaMP6s into the hippocampal DG and performed fiber photometry to record the population

signals from DG neurons after SB242084 or CP809101 or vehicle treatment (Fig. 2D).

We analyzed the mean GCaMP fluorescence during 0-30 min and 30-60 min periods, and

found that there was no difference between SB242084 or CP809101 and vehicle in

intracellular Ca

signal within the initial 30 min. However, SB242084 administration elicited

a reduction in the Ca

signal, whereas CP809101 increased the Ca

signal compared to

vehicle during the 30-60 time periods (Fig. 2E-H). Given the conceivable involvement of

signal in nNOS-CAPON association, we measured the levels of the hippocampal nNOS-

CAPON complex of mice treated with SB242084 or CP809101, together with calcium

ionophore A23187 or endoplasmic reticulum Ca

-ATPase inhibitor Xestospongin C (Fig. 2I).

Intriguingly, our findings indicated that 5-HT

R modulated the nNOS-CAPON association

via intracellular Ca

, as further evidenced by that calcium ionophore A23187 canceled the

SB242084-augmented nNOS-CAPON binding (Fig. 2J), and Xestospongin C reversed the

CP809101-attenuated nNOS-CAPON interaction (Fig. 2K).

To explore the role of hippocampal nNOS-CAPON interaction in 5-HT

R-regulated

depressive behaviors, the mice were treated by SB242084 alone or in combination with ZLc-

002, a small molecule compound blocking nNOS-CAPON coupling (Fig. 3A).

14,15,28

expected, ZLc-002 reduced the level of nNOS-CAPON complex and counteracted the effects

of SB242084 on nNOS-CAPON interaction (Fig. 3B and C). More importantly, ZLc-002

ameliorated SB242084 induced depressive-like behaviors, which were characterized by the

reduced immobility time in TST and FST, and increased sucrose preference in SPT (Fig. 3D-

F). Furthermore, we used another 5-HT

R antagonist RS-102221 (2 mg/kg, i.p.) alone or in

combination with ZLc-002 to further confirm these observations (Fig. 3G). The results

showed that ZLc-002 reversed RS-102221-increased nNOS-CAPON association (Fig. 3H and

I). Similarly, RS-102221 induced significant depressive-like behaviors in mice, ZLc-002

ameliorated RS-102221 increased immobility time in TST and FST, and reduced sucrose

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

preference in SPT (Fig. 3J-L). Meanwhile, we microinfused AAV-CAPON-125C-GFP, a

blocker of nNOS-CAPON association,

into hippocampal DG of mice combined with

intraperitoneal SB242084 treatment to further confirm the involvement of nNOS-CAPON

association in 5-HT

R-modulated depressive behaviors (Fig. 3M). The CO-IP results

showed that AAV-CAPON-125C-GFP attenuated the nNOS-CAPON association induced by

SB242084 (Fig. 3N and O). Moreover, the behavioral results demonstrated that AAV-

CAPON-125C-GFP reversed the SB242084 induced depressive-like behaviors (Fig. 3P-R).

Taken together, these findings demonstrate that Ca

-modulated hippocampal nNOS-

CAPON interaction mediates the behavioral modifications of 5-HT

SNARE complex assembly modulated by nNOS-CAPON coupling

underlies the behavioral effects of 5-HT

Considering the crucial involvement of SNARE assembly in the vesicle dynamics and

neurotransmitter exocytosis,

we investigated whether 5-HT

R modulates the SNARE

complex assembly in the hippocampus. We quantified the amount of assembled SNARE

complexes in hippocampal synaptosome samples obtained from the mice treated with

SB242084 alone or combined with AAV-CAPON-125C-GFP. Interestingly, SB242084

treatment induced a reduction in assembled SNARE complexes, which was effectively

counteracted by AAV-CAPON-125C-GFP (Fig. 4A-D). In addition, we treated the mice with

SB242084 intraperitoneally or in combination with intrahippocampal infusion of ZLc-002 to

further confirm the effect of 5-HT

R on the assembly of SNARE complex. Our results

consistently indicated that ZLc-002 significantly reversed the reduction in SNARE complex

assembly induced by SB242084 (Fig. 4E-H). These findings strongly support the notion that

blockade of 5-HT

R disrupts the assembly of SNARE complex by enhancing nNOS-

CAPON interaction in the hippocampus.

To explore whether altered hippocampal SNARE complex assembly is involved in the

behavioral modulation of 5-HT

R, we conducted tetanus neurotoxin (TeNT) to de-assembly

SNARE complex by cleaving VAMP2 (Fig. 4I). We infused AAV-hSyn-creERT2 along with

AAV-EF1a-DIO-TeNT-EGFP or AAV-EF1a-DIO-EGFP into the hippocampal DG, and

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

treated the mice with tamoxifen to induce the expression of Cre recombinase, and

subsequently performed the behavioral tests after SB242084 and/or ZLc-002 treatment (Fig.

4J). Immunofluorescence and western blot results confirmed the virus infected in the

hippocampal DG and cleaved VAMP2 successfully (Fig. 4K and L). Expectantly, ZLc-002

reversed the reduction in SNARE complex assembly induced by SB242084, whereas TeNT

abolished the effect of ZLc-002 in mice treated with SB242084 (Fig. 4M-O). Most

importantly, we found that ZLc-002 alleviated the depressive-like behaviors induced by

SB242084, while TeNT neutralized the behavioral effects of ZLc-002 in the presence of

SB242084 (Fig. 4P and Q). These results collectively indicate that nNOS-CAPON coupling

affected SNARE complex assembly mediates the behavioral effects of 5-HT

In all of the behavioral experiments, the treatments displayed no effect on the locomotor

activity in the OFT (Supplementary Table 2).

Disruption of nNOS-CAPON rescues 5-HT

R blockade-impaired

E/I balance via affecting GABA release

Impairment of SNARE complex assembly could lead to abnormal neurotransmitter

release.

29,30

To confirm whether nNOS-CAPON interaction mediates the effect of 5-HT

on neurotransmitter release, we performed microdialysis coupled with UPLC-MS/MS to

measure the extracellular levels of neurotransmitters in the hippocampal CA3 subregion of

mice treated with SB242084 or in combination with AAV-CAPON-125C-GFP (Fig. 5A and,

Supplementary Fig. 2 and Supplementary Table 1). Consistent with Fig. 1H, the results

presented that SB242084 markedly reduced GABA level and also caused a decreasing

tendency in glutamate, while AAV-CAPON-125C-GFP reversed the GABA reduction

induced by SB242084 (Fig. 5B and C). Notably, AAV-CAPON-125C-GFP abolished the

effect of SB242084 on Glu/GABA ratio (Fig. 5D). Meanwhile, we found that RS-102221

also reduced GABA level and caused a decreasing tendency in glutamate, and increased the

Glu/GABA ratio, while ZLc-002 abolished the effects of RS-102221 (Fig. 5E-H).

Additionally, we observed that SB242084 and RS-102221 also decreased the levels of

norepinephrine (NE) and dopamine (DA), but increased the 5-HT level, without affecting

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

acetylcholine, homovanillic acid, epinephrine and 5-hydroxyindoleacetic acid; while AAV-

CAPON-125C-GFP and ZLc-002 increased the level of acetylcholine, and reversed the effect

of SB242084 or RS-102221 on 5-HT level (Supplementary Fig. 4A-P).

Moreover, to further confirm 5-HT

R modulates neurotransmitters vesicle release by

affecting SNARE complex assembly, we infused AAV-hSyn-creERT2 and AAV-EF1a-DIO-

TeNT-P2A-EGFP or AAV-EF1a-DIO-EGFP into the hippocampal DG, and subsequently

performed the microdialysis coupled with targeted UPLC-MS/MS after SB242084 and/or

ZLc-002 treatment (Fig. 5I). Consistently, ZLc-002 reversed the reduction in GABA level in

hippocampal CA3 of SB242084-treated mice (Fig. 5J-K). Notably, TeNT obviously abolished

the effect of ZLc-002 on GABA release in CA3 of mice treated with SB242084 (Fig. 5J-K).

ZLc-002 consistently attenuated the SB242084-increased Glu/GABA ratio, whereas TeNT

prevented the ZLc-002-reduced Glu/GABA ratio in the presence of SB242084 (Fig. 5L).

Accordingly, hippocampal DG infusion of AAV-CAPON-125C-GFP or ZLc-002 affected the

GABA release in CA3 subregion is mainly mediated by the mossy fiber-interneuron synapses

in CA3 (Fig. 5M). Additionally, we found that SB242084 consistently decreased the level of

NE, along with a tendency of decreasing DA level (Supplementary Fig 4Q-W). Taken

together, the above results suggest that 5-HT

R regulates the VAMP2-dependent vesicle

release of GABA via affecting nNOS-CAPON coupling.

Abnormal glutamate and GABA release caused E/I imbalance has been implicated in

depressive disorder.

To further elucidate the effect of 5-HT

R on the E/I balance of

hippocampal neurons via regulating nNOS-CAPON coupling, we performed whole-cell

recordings to measure the sIPSCs and sEPSCs from individual CA3 pyramidal neurons in

acute slices (Fig. 5N). The results showed that the frequency of sIPSCs exhibited a reduction

in SB242084 compared to vehicle, which was effectively reversed by ZLc-002 (Fig. 5O and

P). Correspondingly, SB242084 caused a decreasing tendency in the amplitude of sIPSCs, but

ZLc-002 had no effect (Fig. 5O and P). However, neither the frequency nor the amplitudes of

sEPSCs were significantly changed after SB242084 or ZLc-002 treatment (Fig. 5Q and R).

Notably, ZLc-002 exposure abolished the increased sEPSCs/sIPSCs frequency ratio, and thus

ameliorating the E/I imbalance triggered by SB242084 (Fig. 5S).

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

To verify that nNOS-CAPON association-regulated E/I balance in CA3 pyramidal neurons

underlies the effects of 5-HT

R in depressive behaviors, we injected AAV-CAPON-125C-

GFP into DG and expressed eNpHR3.0 in CA3 GABAergic neurons by injecting AAV-

mDLx-eNpHR3.0-EYFP, followed with SB242084 treatment (Fig. 5T). The results

consistently showed that AAV-CAPON-125C-GFP reversed SB242084-increased immobility

time in TST and FST, while optogenetic inhibition of the GABAergic neurons in CA3

prevented the effects of AAV-CAPON-125C-GFP on depressive behaviors in the presence of

SB242084 (Fig. 5U and V).

Taken together, these findings consistently suggest that 5-HT

R inhibition disrupts the E/I

balance in hippocampal CA3 pyramidal neurons via augmenting nNOS-CAPON coupling

and a subsequent reduction in SNARE assembly mediated -GABA vesicle release, ultimately

inducing depressive behaviors.

Discussion

Although the role of 5-HT

R in modulating depressive behaviors has been studied, there are

arguments regarding the implications of 5-HT

Rs due to the conflicting literatures.

The

present study addressed the regulatory role of 5-HT

R in depressive behaviors. We

illustrated that chronic stress caused a reduction in the expression of hippocampal 5-HT

Notably, 5-HT

R blocking enhanced Ca

-modulated nNOS-CAPON coupling, and

impaired SNARE complex assembly, leading to E/I imbalance in hippocampal CA3

pyramidal neurons through decreasing GABA vesicle release, and ultimately giving rise to

depressive-like behaviors (Fig. 6). In conclusion, our findings provide evidence that the

regulation of 5-HT

R in depressive behaviors linked to nNOS-CAPON association-

modulated E/I balance, further suggesting that targeting 5-HT

R may hold promise as a

therapeutic target for depressive disorder.

The 5-HT

R is undergoing pre-mRNA editing to generate distinct isoforms with reduced

constitutive activity.

Studies have reported elevated level of 5-HT

R mRNA editing in the

dorsolateral PFC and anterior cingulate cortex of suicide patients with depression,

results in

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

loss of 5-HT

R ligand binding activity and downstream signalling of the G protein-coupled

receptor. These findings indicate that mRNA editing of 5-HT

R induced reduction in G-

protein coupling efficiency might contribute to the pathogenesis of depressive disorder.

Consistently, our findings have shown that blocking 5-HT

R-coupled G-protein signalling

with its specific antagonist elicits typical depressive-like phenotypes, further supporting the

notion that 5-HT

R signalling deficiency is implicated in depression.

We previously highlighted that hippocampal nNOS-CAPON association was involved in

regulating anxiety and depressive behaviors and partially accounted for the anti-depressant

effects of fluoxetine (a classical selective serotonin reuptake inhibitor, SSRI).

The classical

SSRIs exert antidepressant actions through desensitizing the somatodendritic 5-HT

autoreceptor, and increasing the firing frequency of 5-HT neurons in DRN, promoting the

activation of postsynaptic 5-HT

heteroreceptors, which takes several weeks.

31-33

5-HT

are G

q/11

-coupled receptors that regulate Ca

signals via stimulating phospholipases C

(PLC)/inositol phosphates (IP

Currently, we have observed that agonism or antagonism of

5-HT

Rs induces significant alterations in Ca

signals approximately 30 min later,

subsequently modulating depressive-like behaviors after treatment for 2 h. This rapid

regulatory effect, distinct from the delayed onset action of SSRIs, is likely linked to Ca

modulated nNOS-CAPON interaction, a rapid intracellular signal transduction process of 5-

R. Extensive studies indicate that the 5-HT

R is widely distributed in the brain and is

implicated in modulating diverse behaviors in addition to anxiety and depression, such as

feeding behavior and alcohol consumption.

34,35

Here, we identified nNOS-CAPON coupling-

modulated GABA vesicle release as the crucial molecular mechanism of 5-HT

R in

regulating depressive behaviors, however, whether it may also mediate the regulatory effects

of 5-HT

R on anxiety, alcohol consumption and obesity-related feeding behaviors still needs

further investigation.

Stimulation of N-methyl-D-aspartic acid receptor (NMDAR)-mediated Ca

influx

activates nNOS enzyme activity, facilitating the formation of nNOS-CAPON complex.

However, little is known about the underlying mechanisms governing nNOS-CAPON

coupling. One study implied that phosphorylation of CAPON might disrupt the interaction

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

between nNOS and CAPON by breaking the β-sheet conformation of C-terminus of CAPON.

Additionally, Jaffrey et al., reported that the phosphorylation-derived activation of nNOS

did not alter nNOS-CAPON interaction.

Therefore, the mechanisms governing nNOS-

CAPON interaction need to be further investigated. In the present study, we hypothesized that

intracellular Ca

plays a pivotal role in 5-HT

R-regulated nNOS-CAPON coupling. Indeed,

our findings underscored that SB242084 reduced the intracellular Ca

signal, consequently

leading to an augmented nNOS-CAPON coupling. Of particular significance, the elevated

intracellular Ca

concentration by calcium ionophore A23187 effectively reversed

SB242084-enhanced nNOS-CAPON coupling. Furthermore, our investigations revealed that

the inhibition of IP

-mediated Ca

release by Xestospongin C prevented the CP809101-

induced nNOS-CAPON dissociation. Nevertheless, it should be acknowledged that calcium

ionophore A23187 moderately increased nNOS-CAPON coupling in the hippocampus under

physiological condition.

This seeming contradiction in nNOS-CAPON coupling between

physiological and SB242084-treated conditions could be attributed to the different sources of

. Specifically, SB242084 attenuates the release of Ca

from endoplasmic reticulum by

inhibiting 5-HT

R-PLC signalling cascades, whereas calcium ionophore A23187 elevates

the intracellular Ca

concentration by increasing cellular membrane permeability to Ca

38,39

Consequently, further investigation is warranted to explore the roles and molecular

mechanisms of Ca

originated from distinct pathways in nNOS-CAPON coupling under

both 5-HT

R signalling deficiency and physiological conditions.

In the central nervous system, the E/I balance is primarily maintained by the excitatory

neurotransmitter glutamate and the inhibitory GABA, both of which play crucial roles in

brain functions.

A growing body of evidence demonstrates that disruption in the neuronal E/I

balance may cause neuropsychiatric disorders, such as depression.

Moreover, mounting

evidence indicates that depression may be characterized by reduced GABAergic transmission

and/or heightened glutamatergic transmission.

Notably, it has been reported that activation of

5-HT

R in GABAergic neurons may facilitate the inhibitory feedback control of local

neuron firing.

11,40

Intriguingly, we clarified that 5-HT

R inhibition led to diminished

inhibitory transmission, consequently resulting in a net shift of the E/I balance toward s

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

excitation in hippocampal CA3 pyramidal neurons. Crucially, nNOS-CAPON uncoupling

restored the E/I imbalance induced by 5-HT

R inhibition. These findings suggest that 5-

R regulates neuronal E/I balance by influencing nNOS-CAPON coupling in

hippocampus, and ultimately modulating depressive behaviors. The precise molecular

mechanisms underlying the reduction of inhibitory synaptic transmission in hippocampal

CA3 pyramidal neurons due to 5-HT

R inhibition remain elusive, one plausible explanation

is that 5-HT

R blocking may inhibit the probability of GABA release from presynaptic

terminals of GABAergic interneurons. Consistent with this postulation, our results

demonstrated that 5-HT

R antagonist reduced GABA release in CA3 subregion, leading to a

decrease in the frequency of sIPSCs in hippocampal CA3 pyramidal neurons. Further

exploration is required to illustrate whether 5-HT

R affects the expression and the subunits

composition of the

GABA receptor, which all contributed to the inhibitory signal

transmission. The excitability of CA3 pyramidal neurons is primarily regulated by the mossy

fiber originating from the DG granule cells, which provides robust direct excitation and

indirect feedforward inhibition to CA3 pyramidal neurons.

Currently, our results displayed

that nNOS-CAPON uncoupling in the hippocampal DG reversed the decrease of GABA in

the CA3 subregion caused by 5-HT

R blocking, which may be due to the domination of

mossy fiber to interneurons in CA3 (Figure 5M). As is well-established, GABAergic

interneurons in CA3 encompassing multiple populations defined by distinct markers, such as

the somatostatin, vasoactive intestinal peptide, cholecystokinin, calbindin, and parvalbumin,

all of which providing distinct inhibitory effects on the pyramidal neurons.

41,42

Consequently,

it is worthwhile to determine which interneuron subtype is responsible for the deficit in

GABAergic signal in the hippocampal CA3 induced by 5-HT

R inhibition.

The assembly of SNARE complex, formed by vesicular VAMP2 with the plasma

membrane proteins syntaxin-1A and SNAP-25, is the core step in synaptic vesicle fusion

during neurotransmitter release.

12,30

Consistently, our results have shown that inhibition of 5-

R decreased the assembly of SNARE complex, which may provide a theoretical

foundation for the observed reduction in levels of the released neurotransmitters, such as

GABA, glutamate, DA, and NE induced by 5-HT

R blocking. Importantly, disrupting

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

SNARE complex assembly with TeNT abolished the effects of nNOS-CAPON dissociation

on GABA release and subsequent behavioral modifications in the presence of SB242084.

These findings suggest that nNOS-CAPON coupling modulated-SNARE assembly

constitutes pivotal mechanism underlying the effects of 5-HT

R on E/I balance and

depressive behaviors.

It is noteworthy that beyond GABA, our findings have shown that 5-HT

R inhibition also

resulted in altered release of other neurotransmitters, such as 5-HT and DA. In line with our

observations, previous studies indicate that 5-HT

Rs are expressed in diverse cell types,

including GABAergic neurons, excitatory neurons, dopaminergic neurons and others.

43,44

There are evidences that 5-HT

R on GABAergic neurons negatively regulates the firing

activity of 5-HT neurons within DRN, the principal origin of 5-HT in hippocampus.

11,45

This

may partially explain our findings regarding the elevation of 5-HT level in hippocampal CA3

induced by 5-HT

R antagonists. Additionally, our results have shown that 5-HT

inhibition decreased the level of DA, whereas hippocampal DG nNOS-CAPON dissociation

didn’t change the effect of 5-HT

R inhibition on DA release in hippocampal CA3,

suggesting that there may be other mechanisms beyond nNOS-CAPON interaction involved

in 5-HT

R-modulated behaviors. The hippocampus contains dopaminergic terminals

originating from the ventral tegmental area (VTA) that project to different layers in DG, CA3

and CA1 subregions.

Notably, we observed that 5-HT

R inhibition reduced DA level in the

hippocampal CA3, which may be attributed to the altered activity of dopaminergic neuron in

VTA. Considering the established role of DA in regulating depressive behaviors, these

findings indicate the possibility that a contribution of DA reduction to the behavioral

outcomes of 5-HT

R inhibition cannot be ruled out.

In summary, our results underscore that 5-HT

R inhibition disrupts the E/I balance in

hippocampal CA3 pyramidal neurons via enhancing nNOS-CAPON interaction and the

subsequent impairment of SNARE assembly-mediated neurotransmitter vesicle release,

thereby generating the depression-like behaviors. These findings advance our understanding

of the intricate involvement of the 5-HT

R in the pathophysiology of psychiatric disorders,

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

and provide a promising target for the development of pharmacological agents to address

these diseases.

Data availability

The data that support the findings of this study are available on request from the

corresponding author. The accession number for RNA sequencing data used in this paper is

GenBank: GSE151807.

Acknowledgements

We thank other members of the laboratory for discussions.

Funding

This work was supported by grants from the National Natural Science Foundation of China

(32371068, 31970951, 31671107 to L.J.Z.), the Natural Science Foundation of Jiangsu

Province (BK20170021 to L.J.Z.), the Six Talent Peaks Project of Jiangsu Province (YY-005

to L.J.Z.). This work was sponsored by Shanghai Rising-Star Program (21QA1407900 to

L.J.Z.), and Shanghai Municipal Education Commission (2021-01-07-00-02-E0086 to Z.W.),

the Fundamental Research Funds for the Central Universities (2242023K40035 to L.J.Z.) and

Zhishan Scholars Programs of Southeast University (to L.J.Z.).

Competing interests

The authors report no competing interests.

Supplementary material

Supplementary material is available at

Brain

online.

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

References

Global, regional, and national burden of 12 mental disorders in 204 countries and

territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019.

Lancet Psychiatry

. Feb 2022;9(2):137-150. doi:10.1016/s2215-0366(21)00395-3

Global prevalence and burden of depressive and anxiety disorders in 204 countries

and territories in 2020 due to the COVID-19 pandemic.

Lancet

. Nov 6

2021;398(10312):1700-1712. doi:10.1016/s0140-6736(21)02143-7

Pourhamzeh M, Moravej FG, Arabi M

, et al

. The Roles of Serotonin in

Neuropsychiatric

Disorders.

Cell

Mol

Neurobiol

Aug

2022;42(6):1671-1692.

doi:10.1007/s10571-021-01064-9

Chagraoui A, Thibaut F, Skiba M, Thuillez C, Bourin M. 5-HT2C receptors in

psychiatric disorders: A review.

Prog Neuropsychopharmacol Biol Psychiatry

. Apr 3

2016;66:120-135. doi:10.1016/j.pnpbp.2015.12.006

Martin CB, Hamon M, Lanfumey L, Mongeau R. Controversies on the role of 5-

HT(2C) receptors in the mechanisms of action of antidepressant drugs.

Neurosci Biobehav

Rev

. May 2014;42:208-23. doi:10.1016/j.neubiorev.2014.03.001

Lu K, Hong Y, Tao M

, et al

. Depressive patient-derived GABA interneurons reveal

abnormal neural activity associated with HTR2C.

EMBO Mol Med

. Jan 11

2023;15(1):e16364. doi:10.15252/emmm.202216364

Gurevich I, Tamir H, Arango V, Dwork AJ, Mann JJ, Schmauss C. Altered editing of

serotonin 2C receptor pre-mRNA in the prefrontal cortex of depressed suicide victims.

Neuron

. Apr 25 2002;34(3):349-56. doi:10.1016/s0896-6273(02)00660-8

Lener MS, Niciu MJ, Ballard ED

, et al

. Glutamate and Gamma-Aminobutyric Acid

Systems in the Pathophysiology of Major Depression and Antidepressant Response to

Ketamine.

Biol

Psychiatry

May

2017;81(10):886-897.

doi:10.1016/j.biopsych.2016.05.005

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

Moreau AW, Amar M, Le Roux N, Morel N, Fossier P. Serotoninergic fine-tuning of

the excitation-inhibition balance in rat visual cortical networks.

Cereb Cortex

. Feb

2010;20(2):456-67. doi:10.1093/cercor/bhp114

10.

Meunier CNJ, Cancela JM, Fossier P. Lack of GSK3β activation and modulation of

synaptic plasticity by dopamine in 5-HT1A-receptor KO mice.

Neuropharmacology

. Feb

2017;113(Pt A):124-136. doi:10.1016/j.neuropharm.2016.09.025

11.

Spoida K, Masseck OA, Deneris ES, Herlitze S. Gq/5-HT2c receptor signals activate

a local GABAergic inhibitory feedback circuit to modulate serotonergic firing and anxiety in

mice.

Proc

Natl

Acad

Sci

Apr

2014;111(17):6479-84.

doi:10.1073/pnas.1321576111

12.

Acuna C, Guo Q, Burré J, Sharma M, Sun J, Südhof TC. Microsecond dissection of

neurotransmitter release: SNARE-complex assembly dictates speed and Ca²⁺ sensitivity.

Neuron

. Jun 4 2014;82(5):1088-100. doi:10.1016/j.neuron.2014.04.020

13.

Shi HJ, Wu DL, Chen R, Li N, Zhu LJ. Requirement of hippocampal DG nNOS-

CAPON dissociation for the anxiolytic and antidepressant effects of fluoxetine.

Theranostics

2022;12(8):3656-3675. doi:10.7150/thno.70370

14.

Zhu LJ, Shi HJ, Chang L

, et al

. nNOS-CAPON blockers produce anxiolytic effects by

promoting synaptogenesis in chronic stress-induced animal models of anxiety.

Br J

Pharmacol

. Aug 2020;177(16):3674-3690. doi:10.1111/bph.15084

15.

Zhu LJ, Li TY, Luo CX

, et al

. CAPON-nNOS coupling can serve as a target for

developing new anxiolytics.

Nat Med

. Sep 2014;20(9):1050-4. doi:10.1038/nm.3644

16.

Li Y, Zeng J, Zhang J

, et al

. Hypothalamic Circuits for Predation and Evasion.

Neuron

. Feb 21 2018;97(4):911-924.e5. doi:10.1016/j.neuron.2018.01.005

17.

Wang YJ, Zan GY, Xu C

, et al

. The claustrum-prelimbic cortex circuit through

dynorphin/κ-opioid receptor signaling underlies depression-like behaviors associated with

social stress etiology.

Nat Commun

. Nov 30 2023;14(1):7903. doi:10.1038/s41467-023-

43636-x

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

18.

Zhu LJ, Chang L, Shi HJ, Li N. Systemic administration of ZLc-002 exerts

anxiolytic-like effects by dissociation of nNOS from CAPON in adult mice.

Biochem

Biophys Res Commun

. Mar 5 2020;523(2):299-306. doi:10.1016/j.bbrc.2019.12.037

19.

Tan GH, Liu YY, Wang L

, et al

. PRRT2 deficiency induces paroxysmal kinesigenic

dyskinesia by regulating synaptic transmission in cerebellum.

Cell Res

. Jan 2018;28(1):90-

110. doi:10.1038/cr.2017.128

20.

Yang Y, Kim J, Kim HY

, et al

. Amyloid-β Oligomers May Impair SNARE-Mediated

Exocytosis by Direct Binding to Syntaxin 1a.

Cell Rep

. Aug 25 2015;12(8):1244-51.

doi:10.1016/j.celrep.2015.07.044

21.

Ba R, Yang L, Zhang B

, et al

. FOXG1 drives transcriptomic networks to specify

principal neuron subtypes during the development of the medial pallium.

Sci Adv

. Feb 15

2023;9(7):eade2441. doi:10.1126/sciadv.ade2441

22.

Lin YH, Dong J, Tang Y

, et al

. Opening a New Time Window for Treatment of Stroke

Targeting

HDAC2.

Neurosci

Jul

2017;37(28):6712-6728.

doi:10.1523/jneurosci.0341-17.2017

23.

Blanco ME, Mayo OB, Bandiera T, De Pietri Tonelli D, Armirotti A. LC-MS/MS

analysis of twelve neurotransmitters and amino acids in mouse cerebrospinal fluid.

Neurosci Methods

. Jul 15 2020;341:108760. doi:10.1016/j.jneumeth.2020.108760

24.

Wang Q, Kong Y, Wu DY

, et al

. Impaired calcium signaling in astrocytes modulates

autism spectrum disorder-like behaviors in mice.

Nat Commun

. May 31 2021;12(1):3321.

doi:10.1038/s41467-021-23843-0

25.

Biria M, Banca P, Healy MP

, et al

. Cortical glutamate and GABA are related to

compulsive behaviour in individuals with obsessive compulsive disorder and healthy

controls.

Nat Commun

. Jun 27 2023;14(1):3324. doi:10.1038/s41467-023-38695-z

26.

Fang X, Chen Y, Wang J

, et al

. Increased intrinsic and synaptic excitability of

hypothalamic POMC neurons underlies chronic stress-induced behavioral deficits.

Mol

Psychiatry

. Mar 2023;28(3):1365-1382. doi:10.1038/s41380-022-01872-5

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

27.

Li X, Du ZJ, Xu JN

, et al

. mGluR5 in hippocampal CA1 pyramidal neurons mediates

stress-induced anxiety-like behavior.

Neuropsychopharmacology

. Jul 2023;48(8):1164-1174.

doi:10.1038/s41386-023-01548-w

28.

Zhu LJ, Li F, Zhu DY. nNOS and Neurological, Neuropsychiatric Disorders: A 20-

Year Story.

Neurosci Bull

. Apr 19 2023:1-15. doi:10.1007/s12264-023-01060-7

29.

Wang C, Xu B, Ma Z

, et al

. Inhibition of Calpains Protects Mn-Induced

Neurotransmitter release disorders in Synaptosomes from Mice: Involvement of SNARE

Complex and Synaptic Vesicle Fusion.

Sci Rep

. Jun 16 2017;7(1):3701. doi:10.1038/s41598-

017-04017-9

30.

Zhu LJ, Zhang C, Chen C. Research progress on vesicle cycle and neurological

disorders.

J Pharm Pharm Sci

. 2021;24:400-412. doi:10.18433/jpps31458

31.

Lesch KP, Waider J. Serotonin in the modulation of neural plasticity and networks:

implications for neurodevelopmental disorders.

Neuron

. Oct 4 2012;76(1):175-91.

doi:10.1016/j.neuron.2012.09.013

32.

Sun N, Qin YJ, Xu C

, et al

. Design of fast-onset antidepressant by dissociating SERT

from

nNOS

the

DRN.

Science

Oct

2022;378(6618):390-398.

doi:10.1126/science.abo3566

33.

Blier P, Piñeyro G, el Mansari M, Bergeron R, de Montigny C. Role of

somatodendritic 5-HT autoreceptors in modulating 5-HT neurotransmission.

Ann N Y Acad

Sci

. Dec 15 1998;861:204-16. doi:10.1111/j.1749-6632.1998.tb10192.x

34.

Higgins GA, Fletcher PJ. Therapeutic Potential of 5-HT2C Receptor Agonists for

Addictive

Disorders.

ACS

Chem

Neurosci

Jul

2015;6(7):1071-88.

doi:10.1021/acschemneuro.5b00025

35.

Flanigan ME, Hon OJ, D'Ambrosio S

, et al

. Subcortical serotonin 5HT(2c) receptor-

containing neurons sex-specifically regulate binge-like alcohol consumption, social, and

arousal behaviors in mice.

Nat Commun

. Mar 31 2023;14(1):1800. doi:10.1038/s41467-023-

36808-2

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

36.

Cheah JH, Kim SF, Hester LD

, et al

. NMDA receptor-nitric oxide transmission

mediates neuronal iron homeostasis via the GTPase Dexras1.

Neuron

. Aug 17

2006;51(4):431-40. doi:10.1016/j.neuron.2006.07.011

37.

Jaffrey SR, Snowman AM, Eliasson MJ, Cohen NA, Snyder SH. CAPON: a protein

associated with neuronal nitric oxide synthase that regulates its interactions with PSD95.

Neuron

. Jan 1998;20(1):115-24. doi:10.1016/s0896-6273(00)80439-0

38.

Masson J, Emerit MB, Hamon M, Darmon M. Serotonergic signaling: multiple

effectors and pleiotropic effects. 2012:

39.

De BK, Friedberg I. Effect of ionophore A23187 on the membrane permeability in

mouse fibroblasts.

Biochem Biophys Res Commun

. Aug 15 1991;178(3):830-41.

doi:10.1016/0006-291x(91)90966-b

40.

Theile

JW, Morikawa H, Gonzales RA, Morrisett RA. Role of 5-

hydroxytryptamine2C receptors in Ca2+-dependent ethanol potentiation of GABA release

onto ventral tegmental area dopamine neurons.

J Pharmacol Exp Ther

. May

2009;329(2):625-33. doi:10.1124/jpet.108.147793

41.

Shi HJ, Wang S, Wang XP, Zhang RX, Zhu LJ. Hippocampus: Molecular, Cellular,

and

Circuit

Features

Anxiety.

Neurosci

Bull

Jun

2023;39(6):1009-1026.

doi:10.1007/s12264-023-01020-1

42.

Rebola N, Carta M, Mulle C. Operation and plasticity of hippocampal CA3 circuits:

implications for memory encoding.

Nat Rev Neurosci

. Apr 2017;18(4):208-220.

doi:10.1038/nrn.2017.10

43.

Li X, Chen W, Pan K

, et al

. Serotonin receptor 2c-expressing cells in the ventral CA1

control attention via innervation of the Edinger-Westphal nucleus.

Nat Neurosci

. Sep

2018;21(9):1239-1250. doi:10.1038/s41593-018-0207-0

44.

Bubar MJ, Cunningham KA. Distribution of serotonin 5-HT2C receptors in the

ventral

tegmental

area.

Neuroscience

Apr

2007;146(1):286-97.

doi:10.1016/j.neuroscience.2006.12.071

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

Figure legends

Figure 1 5-HT

R is involved in the regulation of hippocampal E/I balance and

depressive behaviors.

(

) Heatmap of the DEGs of hippocampus related to the 5-HT

receptors in CMS-exposed and control mice. (

) qPCR result showing the 5-HT

R mRNA

level in the hippocampus of mice exposed to CMS (n = 4, unpaired

-test,

(6)

= 3.547, *

0.0121). (

) Representative immunoblots (upper) and bar graph (lower) showing the protein

level of 5-HT

R in the hippocampus of CMS-exposed and control mice (n = 6, unpaired

test,

(10)

= 2.562, *

= 0.0283). (

and

) The immobility time in TST and FST of mice

treated with SB242084 (

) or CP809101 (

) compared to vehicle (n = 10, unpaired

-test,

SB242084

TST

(18)

= 2.572, *

= 0.0192; SB242084

FST

(18)

= 2.546, *

= 0.0203;

CP809101

TST

(18)

= 3.669, **

= 0.0018; CP809101

FST

(18)

= 4.204, ***

= 0.0005). (

)

UPLC-MS/MS analysis of the dialysates from hippocampal CA3 of mice. (

)

Chromatographic peaks of averaged GABA and glutamate intensities in the hippocampal

CA3 dialysates of mice treated with vehicle or SB242084. (

) Bar graphs showing the

content of GABA and glutamate in the dialysates of hippocampal CA3 (n = 4, unpaired

-test,

GABA:

(6)

= 4.74, **

= 0.0032; glutamate:

(6)

= 2.423,

= 0.0517). (

) The ratio of

glutamate to GABA in response to vehicle or SB242084 treatments (n = 4, unpaired

-test,

(6)

= 3.207, *

= 0.0184). (

) Schematic diagram for whole cell recording of hippocampal

CA3 pyramidal neurons (

) in acute slices incubated with vehicle or SB242084 for 1 h.

sIPSCs and sEPSCs were recorded from the same neurons at 0 mV and -70 mV, respectively.

(

) Representative sIPSC and sEPSC traces of CA3 pyramidal neurons. (

) Summary graphs

for cumulative distributions of the frequency and mean frequency, cumulative distributions of

the amplitude and mean amplitude of sIPSCs (n = 15 cells from 5 animals, unpaired

-test,

frequency:

(21.55)

= 4.763, ****

< 0.0001; amplitude:

(28)

= 1.77,

= 0.2931). (

)

Summary graphs for cumulative distributions of the frequency and mean frequency,

cumulative distributions of the amplitude and mean amplitude of sEPSCs (n = 15 cells from 5

animals, unpaired

-test, frequency:

(28)

= 1.83,

> 0.999; amplitude:

(28)

= 1.83,

0.999). (

) The ratio of sEPSCs/sIPSCs frequency and amplitudes (n = 15 cells from 5

animals, unpaired

-test, frequency:

(28)

= 2.27, *

= 0.0311; amplitudes:

(28)

= 1.34,

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

0.4312). CMS, chronic mild stress; sIPSCs, spontaneous inhibitory postsynaptic currents;

sEPSCs, spontaneous excitatory postsynaptic currents; TST, tail suspension test; FST, forced

swim test. Data are presented as means ± SEM.

Figure 2 5-HT

R regulates hippocampal nNOS-CAPON association through affecting

intracellular Ca

release.

(

) The nNOS-CAPON complex levels (presented as the ratio of

CAPON to nNOS) in the hippocampus of mice treated with SB242084, CP809101 or their

vehicle (n = 4, unpaired

-test, SB242084:

(6)

= 2.629, *

= 0.0391; CP809101:

(6)

= 3.977,

= 0.0073). (

) The nNOS-CAPON complex levels in the hippocampus of mice treated

with CMS exposure and CP809101 (n = 4, two-way ANOVA with Tukey’s multiple

comparison tests,

(3, 6)

= 0.5699, Control vs. CMS, *

= 0.0277; CMS vs.

CMS+CP809101, *

P =

0.0388). (

) Sankey diagram based on analysis of significantly

enriched GO terms of the distinct 5-HT receptor subtypes identified in Figure 1A. (

)

Schematic of the fiber-photometry of the GCaMP6s-expressing DG neurons from the

hippocampus of freely behaving mice.

(D1)

Microinjecting recombinant AAV-hsyn-

GCaMP6s into the hippocampal DG of adult mice results in GCaMP6s expression (green) in

hippocampal neurons. (

) Heatmap illustration (upper) and average GCaMPs signal

(lower) aligned to the treatment with vehicle (

) or SB242084 (

) or CP809101 (

). (

)

Average dF/F values of GCaMP6s signals in response to vehicle or SB242084 or CP809101

treatment during time 0-30 min and 30-60 min periods. (n = 3, unpaired

-test, 0-30 min:

Vehicle vs. SB242084:

(4)

= 0.1536,

= 0.8854; Vehicle vs. CP809101:

(4)

= 1.501,

0.2078; 30-60 min: Vehicle vs. SB242084:

(4)

= 4.057, *

= 0.0154; Vehicle vs. CP809101:

(4)

= 4.365, *

= 0.012). (

) Schematic workflow outlining the experimental procedure for

mice treated with SB242084/CP809101 and/or A23187/Xec, and followed with CO -IP

analysis. (

) The representative immunoblots (upper) and bar graph (lower) demonstrating

the association of nNOS and CAPON in hippocampus of mice treated with A23187 and/or

SB242084 (n = 6, one-way ANOVA with

Tukey’s multiple comparison tests, F

(3, 20)

0.2417, Vehicle vs. A23187,

= 0.1044; Vehicle vs. SB242084, ***

= 0.0002; SB242084

vs. SB242084+A23187, ***

= 0.0004). (

) The representative immunoblots (upper) and

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

bar graph (lower) showing the association of nNOS and CAPON in hippocampus of mice

treated with XeC and/or CP809101 (n = 4, one-way ANOVA with

Tukey’s multiple

comparison tests, F

(3, 12)

= 1.208, Vehicle vs. Xec,

= 0.0915; Vehicle vs. CP809101, *

0.0451; CP809101 vs. CP809101+Xec, **

= 0.0095). DM, dichroic mirror; PMT,

photomultiplier tube. GO, Gene ontology; XeC, Xestospongin C. Data are presented as

means ± SEM.

Figure 3 Hippocampal nNOS-CAPON coupling mediates the behavioral consequences

of 5-HT

(

) Schematic workflow showing the experimental procedure for mice treated

with ZLc-002 and/or SB242084, followed by behavioral assessments. (

and

) The

representative immunoblots (

) and bar graph (

) showing the association of nNOS and

CAPON in the hippocampus (n = 4, one-way ANOVA with Tukey’s multiple comparison

tests, F

(3, 12)

= 0.4337, Vehicle vs. ZLc-002,

= 0.0202; Vehicle vs. SB242084,

= 0.0119;

SB242084 vs. SB242084+ZLc-002, *

= 0.0055). (

-F) The immobility time of mice in the

TST, FST, and sucrose preference in SPT (n = 10, one-way ANOVA with Tukey’s multiple

comparison tests for TST and, FST, and SPT, TST: F

(3, 36)

= 2.434, Vehicle vs. ZLc-002,

0.0433; Vehicle vs. SB242084,

***P

= 0.0004; SB242084 vs. SB242084+ZLc-002, *

0.0035; FST: F

(3, 36)

= 1.217, Vehicle vs. ZLc-002,

= 0.0548; Vehicle vs. SB242084,

***P

= 0.0007; SB242084 vs. SB242084+ZLc-002, *

= 0.0128; SPT: F

(3, 36)

= 1.369, Vehicle vs.

ZLc-002,

= 0.0633; Vehicle vs. SB242084,

**P

= 0.0015; SB242084 vs. SB242084+ZLc-

002, *

= 0.0066). (

) Schematic workflow showing the experimental procedure for mice

treated with ZLc-002 and/or RS-102221, followed by behavioral assessments. (

and

) The

representative immunoblots (

) and bar graph (

) showing the association of nNOS and

CAPON in the hippocampus (n = 4, one-way ANOVA with Tukey’s multiple comparison

tests, F

(3, 12)

= 1.487, Vehicle vs. ZLc-002,

= 0.0379; Vehicle vs. RS-102221,

= 0.0146;

RS-102221 vs. RS-102221+ZLc-002, *

= 0.0018). (

J-L

) The immobility time of mice in

the TST, FST, and sucrose preference in SPT (n = 8, one-way ANOVA with Tukey’s multiple

comparison tests for TST, FST, and SPT, TST: F

(3, 28)

= 0.2098, Vehicle vs. ZLc-002,

0.0303; Vehicle vs. RS-102221,

= 0.0303; RS-102221 vs. RS-102221+ZLc-002, *

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

0.0057; SPT: F

(3, 28)

= 1.283, Vehicle vs. ZLc-002,

= 0.2304; Vehicle vs. RS-102221,

***P

= 0.0002; RS-102221 vs. RS-102221+ ZLc-002, *

**P

= 0.0004; FST: F

(3, 28)

= 0.4139,

Vehicle vs. ZLc-002,

= 0.0375; Vehicle vs. RS-102221,

= 0.035; RS-102221 vs. RS-

102221+ZLc-002,

= 0.0228). (

) Schematic workflow showing the experimental

procedure for mice treated with AAV-CAPON-125C-GFP and/or SB242084, followed by

behavioral tests. (

and

) The representative immunoblots (

) and bar graph (

) showing

the association of nNOS and CAPON in the hippocampus of mice (n = 4, Welch ANOVA

with Dunnett's T3 multiple comparisons tests, W

(3, 5.563)

= 20.8, Vehicle+GFP vs.

Vehicle+125C-GFP,

= 0.0494; Vehicle+GFP vs. SB242084+GFP,

= 0.0322;

SB242084+GFP vs. SB242084+125C-GFP,

= 0.0392). (

P-R

) The immobility time of

mice in the TST, and FST, and sucrose preference in SPT (n = 7, one-way ANOVA with

Tukey’s multiple comparison tests for TST, FST, and SPT, TST:

(3, 24)

= 2.128, Vehicle+GFP

vs. Vehicle+125C-GFP,

= 0.1133; Vehicle+GFP vs. SB242084+GFP,

**P

= 0.0095;

SB242084+GFP vs. SB242084+125C-GFP,

= 0.0243; FST: F

(3, 24)

= 0.2984, Vehicle+GFP

vs. Vehicle+125C-GFP, *

= 0.0175; Vehicle+GFP vs. SB242084+GFP,

= 0.012;

SB242084+GFP vs. SB242084+125C-GFP,

= 0.0149; SPT: F

(3, 24)

= 0.504, Vehicle+GFP

vs. Vehicle+125C-GFP,

= 0.1722; Vehicle+GFP vs. SB242084+GFP,

****P

< 0.0001;

SB242084+GFP vs. SB242084+125C-GFP,

**P

= 0.0061). SPT, sucrose preference test.

Data are presented as means ± SEM.

Figure 4 nNOS-CAPON coupling-modulated SNARE complex assembly underlies the

behavioral effects of 5-HT

(

) Representative immunoblots (

) and bar graphs

(

) showing the formation of SNARE complex within hippocampal synaptosomes of mice

treated with AAV-CAPON-125C-GFP and/or SB242084 (n = 4, Welch ANOVA with

Dunnett's T3 multiple comparisons tests for SNAP25, W

(3, 6.458)

= 30.69, Veh+GFP vs.

Veh+125C-GFP,

= 0.0379; Veh+GFP vs. SB+GFP,

= 0.0141; SB+GFP vs. SB+125C-

GFP,

***P

= 0.0006; one-way ANOVA with Tukey’s multiple comparison tests for syntaxin

1A and VAMP2, syntaxin 1A: F

(3, 12)

= 0.2561, Veh+GFP vs. Veh+125C-GFP,

****P

0.0001; Veh+GFP vs. SB+GFP,

**P

= 0.0022; SB+GFP vs. SB+125C-GFP,

***P

= 0.0005;

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

VAMP2: F

(3, 12)

= 1.37, Veh+GFP vs. Veh+125C-GFP,

***P

= 0.0002; Veh+GFP vs. SB+GFP,

= 0.0478; SB+GFP vs. SB+125C-GFP,

**P

= 0.0071). (

) Representative

immunoblots (

) and bar graphs (

) showing the formation of SNARE complex within

hippocampal synaptosomes of mice treated with ZLc-002 and/or SB242084 (n = 4, Welch

ANOVA with Dunnett's T3 multiple comparisons tests for SNAP25 and VAMP2, SNAP25:

(3, 6.266)

= 25.94, Veh vs. ZLc,

= 0.0538; Veh vs. SB,

= 0.0274; SB vs. SB+ZLc,

**P

0.0037; VAMP2: W

(3, 6.017)

= 16.74, Veh vs. ZLc,

= 0.0994; Veh vs. SB,

= 0.0182; SB

vs. SB+ZLc,

= 0.0476; one-way ANOVA with Tukey’s multiple comparison tests for

syntaxin 1A, F

(3, 12)

= 1.603, Veh vs. ZLc, ***

= 0.0008; Veh vs. SB,

= 0.042; SB vs.

SB+ZLc,

***P

= 0.0005). (

) Model of TeNT blocking SNARE assembly-mediated

neurotransmitter release through cleavage of VAMP2. (

) The diagram showing the

experimental procedure for mice treated with SB242084, ZLc-002, and/or AAV-TeNT-P2A-

GFP. (

) Fluorescence image showing the infection of AAV-TeNT-P2A-GFP in the

hippocampal DG of adult mice. (

) Representative immunoblot and bar graph showing

VAMP2 protein in hippocampus after treated with AAV-TeNT-P2A-GFP (n = 3, one-way

ANOVA with Tukey’s multiple comparison tests, F

(3, 8)

= 0.9393, Veh+GFP vs. SB+GFP,

0.7725; SB+GFP vs. SB+ZLc+GFP,

= 0.9947; SB+ZLc+GFP vs. SB+ZLc+ TeNT-GFP, *

= 0.0226). (

) Representative immunoblots (upper) and bar graphs (lower) showing the

assembly of SNARE complex within hippocampal synaptosomes (n = 4, one-way ANOVA

with Tukey’s multiple comparison tests, SNAP25: F

(3, 12)

= 1.526, Veh+GFP vs. SB+GFP,

***

= 0.0003; SB+GFP vs. SB+ZLc+GFP, **

= 0.0061; SB+ZLc+GFP vs.

SB+ZLc+TeNT-GFP, **

= 0.0029; syntaxin 1A: F

(3, 12)

= 0.5519, Veh+GFP vs. SB+GFP,

= 0.0014; SB+GFP vs. SB+ZLc+GFP, *

= 0.0179; SB+ZLc+GFP vs. SB+ZLc+TeNT-

GFP, **

= 0.0026; VAMP2: F

(3, 12)

= 1.624, Veh+GFP vs. SB+GFP, ***

= 0.0006;

SB+GFP vs. SB+ZLc+GFP, *

= 0.0204; SB+ZLc+GFP vs. SB+ZLc+TeNT-GFP, *

0.0289). (

and

) The immobility time in TST (

) and FST (

) (n = 7, one-way ANOVA

with Tukey’s multiple comparison tests, TST: F

(3, 24)

= 1.406, Veh+GFP vs. SB+GFP, ***

0.0002; SB+GFP vs. SB+ZLc+GFP, **

= 0.0094; SB+ZLc+GFP vs. SB+ZLc+ TeNT-GFP,

= 0.0165; FST: F

(3, 24)

= 0.4902, Veh+GFP vs. SB+GFP, ***

= 0.0003; SB+GFP vs.

SB+ZLc+GFP, *

= 0.0245; SB+ZLc+GFP vs. SB+ZLc+TeNT-GFP, *

= 0.0411). Veh,

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

vehicle; SB, SB242084; ZLc, ZLc-002; TeNT, tetanus neurotoxin. Data are presented as

means ± SEM.

Figure 5 Dissociation of nNOS-CAPON reverses 5-HT

R inhibition induced

impairments in GABA vesicle release and E/I balance.

(

)

Schematic representation of the

experimental procedures for microdialysis of mice treated with SB242084 alone or in

combination with AAV-CAPON-125C-GFP. (

) Chromatographic peaks of averaged GABA

and glutamate intensities in the hippocampal CA3 dialysates of mice treated with SB242084

and/or AAV-CAPON-125C-GFP. (

) Bar graphs showing the content of GABA and

glutamate in the dialysates of hippocampal CA3 (n = 8, Welch ANOVA with Dunnett's T3

multiple comparisons tests for GABA, W

(3, 13.81)

= 29.78, Vehicle+GFP vs. Vehicle+125C-

GFP,

= 0.994; Vehicle+GFP vs. SB242084+GFP, **

= 0.0041; SB242084+GFP vs.

SB242084+125C-GFP,

**P

= 0.007; Kruskal-Wallis ANOVA with Dunn's multiple

comparisons tests for glutamate, H = 7.849, Vehicle+GFP vs. Vehicle+125C-GFP,

> 0.999;

Vehicle+GFP vs. SB242084+GFP,

= 0.0681; SB242084+GFP vs. SB242084+125C-GFP,

> 0.999). (

) The ratio of glutamate to GABA in response to different treatments (n = 8,

Kruskal-Wallis ANOVA with Dunn's multiple comparisons tests, H = 17.71, Vehicle+GFP vs.

Vehicle+125C-GFP,

> 0.999; Vehicle+GFP vs. SB242084+GFP, *

= 0.05;

SB242084+GFP vs. SB242084+125C-GFP, **

= 0.0016). (

) Schematic representation of

the experimental procedures for microdialysis of mice treated with RS-102221 alone or in

combination with ZLc-002. (

) Chromatographic peaks of averaged GABA and glutamate

intensities in the hippocampal dialysates of mice treated with RS-102221 and/or ZLc-002.

(

) Bar graphs showing the content of GABA and glutamate in the dialysates of hippocampal

CA3 (n = 6, one-way ANOVA with Tukey’s multiple comparison tests for GABA and

glutamate, GABA: F

(3, 20)

= 3.715, Vehicle vs. ZLc-002,

= 0.1272; Vehicle vs. RS-102221,

P =

0.0433; RS-102221 vs. RS-102221+ZLc-002, **

= 0.0026; glutamate: F

(3, 20)

= 0.54,

Vehicle vs. ZLc-002,

= 0.2978; Vehicle vs. RS-102221,

P =

0.0864; RS-102221 vs. RS-

102221+ZLc-002,

= 0.2138). (

) The ratio of glutamate to GABA with different treatments

(n = 6, one-way ANOVA with Tukey’s multiple comparison tests, F

(3, 20)

= 1.87, Vehicle vs.

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

ZLc-002,

= 0.3934; Vehicle vs. RS-102221,

P =

0.0892; RS-102221 vs. RS-102221+ZLc-

002, **

= 0.0089). (

)

Schematic representation of the experimental procedures for

microdialysis of mice treated with SB242084 alone or in combination with ZLc-002 and/or

AAV-TeNT-P2A-GFP. (

) Chromatographic peaks of averaged GABA and glutamate

intensities in the hippocampal dialysates of mice treated with SB242084, ZLc-002 and/or

AAV-TeNT-P2A-GFP. (

) Bar graphs showing the content of GABA and glutamate in the

dialysates of hippocampal CA3 (n = 8, Welch ANOVA with Dunnett's T3 multiple

comparisons tests for GABA, W

(3, 12.35)

= 113.1, Veh+GFP vs. SB+GFP, ****

< 0.0001;

SB+GFP vs. SB+ZLc+GFP, **

= 0.0054; SB+ZLc+GFP vs. SB+ZLc+TeNT-GFP, **

0.0014; Kruskal-Wallis ANOVA with Dunn's multiple comparisons tests for glutamate,

H=18.10, Veh+GFP vs. SB+GFP, *

= 0.0394; SB+GFP vs. SB+ZLc+GFP,

> 0.999;

SB+ZLc+GFP vs. SB+ZLc+TeNT-GFP,

P =

0.1315). (

) The ratio of glutamate to GABA

with different treatments (n = 8, Kruskal-Wallis ANOVA with Dunn's multiple comparisons

tests, H = 19.66, Veh+GFP vs. SB+GFP,

= 0.1618; SB+GFP vs. SB+ZLc+GFP, *

0.0462; SB+ZLc+GFP vs. SB+ZLc+TeNT-GFP, ***

P =

0.0008). (

) Cartoon illustrating the

excitatory and inhibitory inputs of CA3 pyramidal neurons. Plus and minus signs represent

excitatory and inhibitory synapses, respectively. (

) Schematic diagram for whole cell

recording of hippocampal CA3 pyramidal neurons in acute slices incubated with SB242084

and/or ZLc-002. (

and

) Representative sIPSC

(O)

and sEPSC

(Q)

traces of CA3

pyramidal neurons. (

) Summary graphs for cumulative distributions of the frequency and

mean frequency, amplitude and mean amplitude of sIPSCs (n = 15 cells from 5 animals, one-

way ANOVA with Tukey’s multiple comparison tests for frequency, F

(3, 56)

= 1.677, Vehicle

vs. ZLc-002,

= 0.1283; Vehicle vs. SB242084, ****

< 0.0001; SB242084 vs.

SB242084+ZLc-002, ****

< 0.0001; Kruskal-Wallis ANOVA with Dunn's multiple

comparisons tests for amplitude: H = 7.304, Vehicle vs. ZLc-002,

> 0.999; Vehicle vs.

SB242084,

= 0.2137; SB242084 vs. SB242084+ZLc-002,

= 0.6175 ). (

) Summary

graphs for cumulative distributions of the frequency and mean frequency, amplitude and

mean amplitude of sEPSCs (n = 15 cells from 5 animals, Kruskal-Wallis ANOVA with

Dunn's multiple comparisons tests for frequency and amplitude, frequency: H = 7.415,

Vehicle vs. ZLc-002,

= 0.7348; Vehicle vs. SB242084,

> 0.999; SB242084 vs.

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024

SB242084+ZLc-002,

> 0.999; amplitude: H = 6.052, Vehicle vs. ZLc-002,

= 0.1252;

Vehicle vs. SB242084,

> 0.999; SB242084 vs. SB242084+ZLc-002,

> 0.999).

(

) The

ratio of sEPSCs/sIPSCs frequency and amplitudes (

= 15 cells from 5 animals, Kruskal-

Wallis ANOVA with Dunn's multiple comparisons tests for frequency, H = 15.89, Vehicle vs.

ZLc-002,

> 0.999; Vehicle vs. SB242084, **

= 0.0053; SB242084 vs. SB242084+ZLc-

002, **

= 0.0032; one-way ANOVA with Tukey’s multiple comparison tests for amplitude,

(3, 56)

= 1.821, Vehicle vs. ZLc-002,

= 0.6862; Vehicle vs. SB242084,

= 0.4249;

SB242084 vs. SB242084+ZLc-002,

= 0.21). (

) Schematic representation of the

experimental procedures for optogenetic inhibition of CA3 GABAergic neurons of mice

treated with SB242084 combination with AAV-CAPON-125C-GFP. (

) The effect of

optogenetic inhibition on spontaneous firing activity of CA3 GABAergic neurons. (

) The

immobility time in TST and FST (n = 5, one-way ANOVA with Tukey’s multiple comparison

tests, TST: F

(3, 16)

= 1.895, Veh+GFP vs. SB+GFP, **

= 0.0014; SB+GFP vs. SB+125C-

GFP, *

= 0.0254; SB+125C-GFP vs. SB+125C-GFP+eNpHR3.0, *

= 0.036; FST: F

(3, 16)

0.8234, Veh+GFP vs. SB+GFP, ***

= 0.0002; SB+GFP vs. SB+125C-GFP,

= 0.0567;

SB+125C-GFP vs. SB+125C-GFP+eNpHR3.0, *

= 0.0399).Veh, vehicle; SB, SB242084;

ZLc, ZLc-002; TeNT, tetanus neurotoxin. Data are presented as means ± SEM.

Figure 6 Schematic illustration of the

molecular and cellular

mechanisms underlying

behavioral consequences of 5-HT

R signalling deficiency.

Chronic stress reduced the

expression of hippocampal 5-HT

R, while inhibition of 5-HT

R with its selective

antagonist enhanced nNOS-CAPON coupling by decreasing intracellular Ca

concentration,

reduced SNARE complex assembly, leading to neuronal E/I imbalance through reducing

vesicle-related GABA release in hippocampal CA3, and ultimately giving rise to depressive-

like behaviors. ER, endoplasmic reticulum; I, inhibition; E, excitation.

ACCEPTED MANUSCRIPT

Downloaded from https://academic.oup.com/brain/advance-article/doi/10.1093/brain/awae143/7664361 by University of California, San Diego user on 08 May 2024