2024.01.21.576568v1.full-html.html

bioRxiv preprint

Abstract

Phenotypic diversity of cancer cells within tumors generated through bi-directional interactions with the tumor

microenvironment has emerged as a major driver of disease progression and therapy resistance. Nutrient

availability plays a critical role in determining phenotype, but whether specific nutrients elicit different responses

on distinct phenotypes is poorly understood. Here we show, using melanoma as a model, that only MITF

Low

undifferentiated cells, but not MITF

High

cells, are competent to drive lipolysis in human adipocytes. In contrast to

MITF

High

melanomas, adipocyte-derived free fatty acids are taken up by undifferentiated MITF

Low

cells via a fatty

acid transporter (FATP)-independent mechanism. Importantly, oleic acid (OA), a monounsaturated long chain

fatty acid abundant in adipose tissue and lymph, reprograms MITF

Low

undifferentiated melanoma cells to a highly

invasive state by ligand-independent activation of AXL, a receptor tyrosine kinase associated with therapy

resistance in a wide range of cancers. AXL activation by OA then drives SRC-dependent formation and nuclear

translocation of a

-catenin-CAV1 complex. The results highlight how a specific nutritional input drives

phenotype-specific activation of a pro-metastasis program with implications for FATP-targeted therapies.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Introduction

Tumors contain multiple, phenotypically distinct cell subpopulations that share common driver mutations but

exhibit radically different biological properties. Specifically, in response to changing microenvironmental cues,

phenotypically plastic cells may reversibly switch

in vivo

from one phenotype to another

(Hanahan, 2022; Hoek

and Goding, 2010).

The ability of cells to change phenotype represents a major challenge to effective anti-cancer

therapy by underpinning metastatic dissemination and contributing to both drug- and immunotherapy-tolerance

(Gerstberger et al., 2023; Kalkavan et al., 2022; Sharma et al., 2010).

Although there have been major advances

in our understanding of how microenvironmental cues impose specific phenotype switches, much less is known

about whether or how specific phenotypic states exhibit distinct responses to the same microenvironment.

Understanding phenotype-specific responses will be crucial to the development of novel and more effective anti-

cancer therapies.

(Rambow et al., 2019).

Although the intratumor microenvironment is complex, one key determinant of cell behaviour is nutrient

availability

(García-Jiménez and Goding, 2019).

To facilitate tumor expansion, cancers induce growth of new

blood vessels to increase nutrient and oxygen supply

(De Palma et al., 2017).

However, the chaotic vasculature

within tumors means that oxygen and nutrients are frequently limiting. Since proliferation is critically dependent

on nutrient availability, instructive cues that trigger cell division also coordinate nutrient uptake and processing

(Pavlova and Thompson, 2016)

. In cancer, activated oncogenes may bypass the need for pro-proliferative signals

and re-wire cellular metabolism

(Pavlova and Thompson, 2016).

However, without a sufficient supply of nutrients,

oncogenes cannot drive cell division. To compensate for limited nutrient availability, cells restrict nutrient demand,

for example by reducing protein translation and slowing the cell cycle

(Falletta et al., 2017; Lee et al., 2021; Vivas-

Garcia et al., 2020)

, and implement strategies that increase nutrient supply

(García-Jiménez and Goding, 2019)

These include adopting an invasive phenotype so as to search for new nutrient supplies, promoting new vessel

formation, increasing uptake of nutrients and engaging autophagy to recycle damaged organelles

(García-Jiménez

and Goding, 2019).

An early response of cells lacking key resources is to trigger metabolic symbiosis by promoting nutrient release

from neighboring cells

(Lyssiotis and Kimmelman, 2017; Martinez-Outschoorn et al., 2014; Nakajima and Van

Houten, 2013; Sonveaux et al., 2008; Sousa et al., 2016).

Adipocytes are designed physiologically to store excess

energy as lipids and release it when required. Increasing evidence suggests this process is subverted in cancer, and

tumor-associated adipocytes can release lipids in response to signals from tumor cells

(Hoy et al., 2021).

Lipids

released by adipocytes can be used to obtain energy or as a carbon source to fuel anabolism in proliferating cancer

cells

(Hoy

et al.

, 2021).

In this respect, invasive cancer cells have frequently been observed in close proximity to

adipocytes

(Muller et al., 2013).

For example, in ovarian cancer lipid transfer from adipocytes in the fat-rich

omentum increases cancer cell proliferation

(Nieman et al., 2011),

while in breast cancer, lipid release from

adipocytes promotes not only cancer cell proliferation

(Balaban et al., 2017)

but also invasion

(Dirat et al., 2011).

Melanoma is a highly aggressive skin cancer with well-defined phenotypic subtypes

(Goodall et al., 2008;

Hoek and Goding, 2010; Rambow

et al.

, 2019; Rambow et al., 2018; Tsoi et al., 2018)

, initially distinguished by

the expression of the Microphthalmia-associated transcription factor MITF

(Goding and Arnheiter, 2019)

that

controls many aspects of melanoma biology including phenotypic identity

Melanoma therefore represents an

excellent model to explore how lipid uptake has consequences for phenotypic identity and disease progression.

Cutaneous melanoma usually originates in the basal layer of the epidermis, and as tumors develop melanoma cells

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

can come into contact with the adipocyte-rich dermis

(Kwan et al., 2014).

Consequently, adipocyte association

with tumors is a marker of poor prognosis

(Smolle et al., 1995),

with adipocyte-derived exosomes promoting fatty

acid oxidation and invasion in melanoma cells

(Lazar et al., 2016).

Importantly, in xenograft melanoma models

peri-tumoral adipocytes exhibit reduced size and characteristics of increased lipolysis

(Wagner et al., 2012).

These

observations are consistent with melanomas inducing lipolysis in adipocytes in culture

(Hollander et al., 1986;

Kwan

et al.

, 2014)

. Moreover, recent compelling evidence from both in vitro and in vivo models indicate that fatty

acids released from stromal adipocytes are imported by melanoma cells using fatty acid transporter proteins

(FATPs) to fuel disease progression

(Lumaquin-Yin et al., 2023; Zhang et al., 2018).

Significantly, oleic acid

uptake from lymph can protect metastasizing melanoma cells from ferroptosis

(Ubellacker et al., 2020)

and FATP-

dependent lipid uptake from aged fibroblasts can contribute to tolerance to BRAF inhibitor therapy

(Alicea et al.,

2020)

. However, while it is clear that fatty acid uptake plays a key role in melanoma biology, mechanistically how

it rewires melanoma signaling to achieve its biological effects are poorly understood. Neither is it understood

whether melanoma phenotype dictates the molecular response to specific fatty acids nor whether the release of

fatty acids from human adipocytes is a response to signals restricted to specific phenotypes.

Here we reveal that only MITF

Low

melanoma cells induce lipolysis in human adipose tissue explants, with

adipocyte lipolysis being triggered by melanoma-derived WNT5a. Surprisingly, we also find that FATP-dependent

uptake of fatty acids is restricted to MITF

High

melanoma cells. In contrast, undifferentiated MITF

Low

AXL

High

therapy-resistant melanoma cells use a FATP-independent but AXL-dependent mechanism to take up fatty acids,

leading to AXL-dependent activation of SRC, phosphorylation of Caveolin 1, translocation of a Caveolin-

catenin complex to the nucleus and increased invasion.

Results

Lipolysis of human adipose tissue explants is induced only by MITF

Low

melanoma

In vivo, metastasizing cancer cells can come into close proximity with adipocytes with the potential for

bidirectional interactions including cancer cell-induced adipocyte lipolysis and uptake of the released fatty acids

by the cancer cells. However, whether human adipocytes release fatty acids in response to signals originating from

specific phenotypic states is unknown. To investigate this, we used two BRAF mutant human melanoma cell lines,

IGR37 and IGR39 that are derived from the same patient but which are phenotypically very different: IGR37 cells

express MITF and represent a proliferative phenotype that is BRAF inhibitor (BRAFi) sensitive; by contrast IGR39

cells are MITF

Low

, undifferentiated, invasive, and BRAFi-tolerant, and express the AXL receptor tyrosine kinase,

a hallmark of therapy resistance. The interaction between melanoma cells and adipocytes was recapitulated by co-

culture with human adipose tissue explants separated by a membrane that permits lipid exchange but does not

allow passage of cells (Figure 1A). Fatty acid uptake by the melanoma cells was then monitored using Nile red, a

fluorescent lipophilic dye. Unexpectedly, only the undifferentiated MITF

Low

IGR39 cells, and not the MITF

High

IGR37 cells accumulated Nile red-stained lipid droplets (Figure 1B). This result might be obtained because only

the IGR39 cells were competent to induce lipolysis in the human adipose tissue explants, and/or because only

IGR39 cells could take up the lipids released from the explants.

To distinguish between these possibilities, we initially examined the ability of both IGR39 and IGR37 cells

to induce phosphorylation of the hormone-stimulated lipase (HSL), a key activation event in mobilization of

adipose tissue fat stores. To ensure that the results were not limited to IGR37 and IGR39 cells, we used two

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

additional melanoma cell lines: WM793, that like IGR39 are MITF

Low

, undifferentiated cells; and 501mel cells,

that like IGR37 exhibit an MITF

High

, proliferative phenotype. Human adipose tissue explants exposed to

conditioned medium derived from the 4 melanoma cell lines for 4 days were examined for HSL phosphorylation

status by Western blot. The results (Figure 1C) revealed that conditioned medium from both undifferentiated

melanoma cell lines (WM793 and IGR39) induced phosphorylation of HSL, but not that from the MITF

High

IGR37

and 501mel cells. In addition, conditioned medium from WM793 and IGR39 cells, but not that from IGR37 or

501mel cells induced expression and phosphorylation of perilipin, a lipid droplet-associated protein and gatekeeper

of lipolysis, whose phosphorylation is a hallmark of adipocyte lipolysis. ERK was used as a loading control.

To extend these observations, we co-cultured IGR37 or IGR39 cells with human adipose tissue explants in

conditioned medium from IGR39 cells, IGR37 cells or in M199 adipocyte culture medium. The results confirmed

that co-cultured undifferentiated IGR39 cells could induce both HSL and perilipin phosphorylation, which was

reduced in the presence of IGR37 conditioned medium or M199 medium. By contrast cocultured IGR37 cells

could not induce markers of lipolysis in the human adipose tissue explants unless cells were exposed to conditioned

medium from IGR39 cells. Collectively, these results indicate that only factors secreted from undifferentiated

melanoma cells could induce lipolysis in human adipose tissue explants.

To rule out any defects in uptake of free fatty acids by IGR37 cells, we next exposed IGR37 and IGR39

cells to oleic acid, an 18:1 long chain monounsaturated fatty acid, and examined the accumulation of lipid droplets.

Oleic acid was used since it is the most abundant fatty acid in human adipose tissue

(Hodson et al., 2008; Insull

and Bartsch, 1967; Kokatnur et al., 1979)

and previous work has shown that uptake of oleic acid from lymph can

enhance survival and suppress ferroptosis in metastasizing melanoma cells (Ubellacker

et al.

, 2020)

In these

experiments we used 100

M oleic acid, a concentration 5-fold lower than that used previously to suppress

ferroptosis (Ubellacker

et al.

, 2020). As expected, exposure of both cell lines to oleic acid led to accumulation of

lipid droplets revealed by staining with Oil Red (Supplementary Figure 1A).

These observations indicate that while IGR37 cells cannot induce lipolysis in human adipose tissue

explants, they are nevertheless capable of importing free fatty acids. We therefore co-cultured IGR37 and IGR39

cells separated by a porous membrane with murine 3T3-L1 adipocytes preloaded with fluorescent BODIPY-FL

that acts as a fatty acid mimetic and which is transported by the same mechanisms as natural lipid

(Bai and Pagano,

1997)

(Supplementary Figure 1B). Any uptake of BODIPY-FL by co-cultured melanoma cells therefore reflects

both its release from the adipocytes as well as an ability of the melanoma cells to import it. Unlike the result

obtained with human adipose tissue explants, IGR37 and IGR39 cells were both able to induce BODIPY-FL

release from the 3T3-L1 cells and its uptake (Supplementary Figure 1C). Taken together our results indicate that

both MITF

Low

and MITF

High

cells can take up oleic acid, but that while both can induce lipid release and uptake

from the murine 3T3-L1 adipocyte, only undifferentiated MITF

Low

cells are competent to induce lipolysis from

human adipose tissue explants and import the lipids released. Collectively, these data suggest that a soluble factor

secreted from MITF

Low

, but not MITF

High

, melanoma cells is able to induce lipolysis and lipid release from human

adipose tissue explants. Although a range of factors might be responsible, to date, no melanoma secreted factor

able to induce lipid release from adipocytes has been identified. However, a number of previous studies suggest

that WNT5a, an activator of the of non-canonical WNT signalling pathway and driver of melanoma invasion

(Weeraratna et al., 2002)

and BRAF inhibitor resistance

(Anastas et al., 2014),

might be a potential candidate.

First, circulating WNT5a can promote a pro-inflammatory state in visceral adipose tissue

(Catalan et al., 2014)

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

and can drive adipocyte dedifferentiation associated with loss of lipid droplets

(Zoico et al., 2016).

Second,

analysis of the panel of melanoma cell lines in the Cancer Cell Line Encyclopedia (CCLE) revealed that WNT5a

was primarily expressed in MITF

Low

cell lines (including IGR39 and WM793 cells) (Figure 1E), using the

expression of the AXL receptor tyrosine kinase (RTK) as an additional marker of MITF

Low

, therapy resistant

phenotype

(Muller et al., 2014).

The results obtained in cell lines were recapitulated in the TCGA melanoma cohort

in which

WNT5a

was expressed predominantly in MITF

Low

tumors (Figure 1F), consistent with both low MITF

(Carreira et al., 2006; Chauhan et al., 2022)

and high WNT5a

(Weeraratna

et al.

, 2002)

being associated with

invasiveness. We therefore tested the ability of WNT5a to induce lipolysis in human adipose tissue explants. The

results (Figure 1G) confirmed that both p-Perilipin and p-HSL were robustly induced by co-culture with IGR39

cells. Although co-culture with IGR37 cells rendered a moderate increase in lipolysis, addition of WNT5a to the

IGR37 cells led to a substantial increase. These data are consistent with WNT5a secreted by MITF

Low

, but not

MITF

High

, cells contributing to their ability to induce lipolysis in human adipose tissue.

Uptake of fatty acids by MITF

Low

melanomas is FATP-independent

The observation that only undifferentiated melanoma cells were competent to induce effective lipolysis from

human adipose tissue explants led us to reassess how fatty acids are transferred into melanoma cells. Previous

work has demonstrated that fatty acid uptake into melanoma cells from adipocytes or aged fibroblasts is mediated

by FATPs and can contribute to therapy resistance (Alicea

et al.

, 2020; Zhang

et al.

, 2018). However, whether

FATPs are also required for fatty acid uptake by undifferentiated melanoma cell lines has not been examined. We

therefore exposed two MITF

High

(501mel and IGR37) and two MITF

Low

(IGR39 and WM793) human melanoma

cell lines to oleic acid in the presence or absence of Lipofermata, a small molecule that specifically blocks the

ability of FATPs to import long-chain fatty acids

(Sandoval et al., 2010)

. The accumulation of intracellular lipid

droplets within the melanoma cells was monitored using Nile red (Figure 2A; quantified in 2B). In the absence of

exogenously added oleic acid, some melanoma cells may contain a few small lipid droplets likely originating from

fatty acids present in the fetal calf serum used in the culture medium. By contrast, addition of oleic acid led to a

dramatic increase in lipid droplet formation in all cell lines, though the level of accumulation in the MITF

Low

(IGR39 and WM793) cell lines was moderately reduced. As anticipated, lipofermata substantially reduced lipid

droplet accumulation in the MITF

High

(501mel and IGR37) cell lines. Unexpectedly, lipofermata exhibited no effect

on lipid droplet accumulation in the MITF

Low

IGR39 and WM793 cell lines. This result raised the possibility that

MITF

Low

undifferentiated melanoma cell lines might use an alternative pathway

to take up long-chain fatty acids.

We therefore examined the mRNA expression of a series of FATPs encoded by the

SLC27A

gene family in our

in-house panel of 12 melanoma cell lines. We also included

CD36

, a fatty acid translocase that is expressed on

metastasis-initiating cells characterized by increased fatty acid metabolism in a number of cancers (Pascual et al.,

2016), and compared its expression to that of MITF, a marker for the more proliferative/differentiated cells.

Remarkably, each cell line expressed a different pattern of FATP or CD36 mRNA expression (Figure 2C). For

example,

CD36

was only significantly expressed in the MITF

Low

WM115 line, while

SLC27A2

, encoding FATP2,

previously implicated in lipid uptake from fibroblasts(Alicea

et al.

, 2020), was only found in two MITF

Low

cell

lines, IGR39 and CHL. By contrast

SLC27A1

encoding FATP1, reported to mediate lipid uptake by melanoma

cells from adipocytes in vivo (Zhang

et al.

, 2018), was more widely expressed, though predominantly in MITF

High

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

cell lines. Notably, one cell line (WM793) appeared to express little of any FATP or

CD36

mRNA, consistent with

its lipofermata-independent lipid droplet accumulation.

To extend these observations we next used a panel of 53 well characterized melanoma cell lines that fall

into 4 distinct phenotypes based on their gene expression profiles (Tsoi

et al.

, 2018). The results (Figure 2D)

largely recapitulated those of our in-house cell lines, with the majority of the FATP genes being more highly

expressed in the MITF

High

Transient or Melanocytic phenotype cells, and

SLC27A2

and

SLC27A6

being expressed

predominantly in a few MITF

Low

undifferentiated or Neural Crest-like cell lines.

CD36

was expressed to high

levels in only 3 lines. These results, together with the observations that lipofermata predominantly affected oleic

uptake in MITF

High

lines, raised the possibility that long chain fatty acid uptake in MITF

Low

melanoma cells is

largely FATP-independent.

One candidate mechanism for fatty acid uptake is via caveolae, cholesterol and sphingolipid-rich lipid rafts

containing the integral membrane protein caveolin. Caveolae have been reported to be important for fatty acid

transport in a number of cell types including adipocytes (Mattern et al., 2009; Pohl et al., 2004; Pohl et al., 2005;

Ring et al., 2006). Remarkably, using the same panel of 53 melanoma cell lines in which different phenotypes can

be distinguished using

MITF

SOX10

, and

SOX9

as markers (Figure 2E), revealed that significant expression of

CAV1

mRNA encoding

Caveolin 1,

a key component of caveolae in plasma membranes (Conde-Perez et al., 2015),

was largely restricted to the MITF

Low

undifferentiated and neural crest-like melanoma cell lines that also express

AXL

, a hallmark of melanoma invasion and therapy resistance (Konieczkowski et al., 2014; Muller

et al.

, 2014).

Similar results were obtained using our in-house panel of lines where RNA-seq (Figure 2F) and western blotting

(Figure 2G) also confirmed that CAV1 expression was largely restricted to the 4 MITF

Low

/AXL

High

cell lines.

Notably, the correlation between AXL and CAV1 expression was not restricted to melanoma cells but was

recapitulated across cancer types in the Cancer Cell Line Encyclopedia (Figure 2H).

To assess the impact of inhibiting caveolae-dependent endocytosis on fatty acid uptake by melanoma cells, we

treated cells with oleic acid and used Nystatin, a sterol-binding compound that disassembles caveolae in the

membrane. As anticipated the uptake of oleic acid by the MITF

High

(501mel and IGR37) cell lines was unaffected

by Nystatin (Figure 2I, J). By contrast, the accumulation of lipid droplets was reduced by Nystatin in both the

MITF

Low

IGR39 and WM793 cells. Collectively the results indicate that while FATPs are used by the lipofermata-

sensitive MITF

High

melanoma cells, MITF

Low

/AXL

High

cells may use alternative mechanisms to take up oleic acid,

including via caveolae. The observation that undifferentiated melanoma cells use a FATP-independent mechanism

for fatty acid uptake is important since blocking FATP activity has been proposed as a potential anti-cancer

therapy.

Oleic acid triggers phenotype-specific translocation of a

-catenin-caveolin complex

To examine the molecular consequences of oleic acid uptake, we focused on the undifferentiated MITF

Low

melanoma cells that can induce lipolysis in human adipose tissue explants and import oleic acid in a lipofermata-

independent fashion. Since CAV1 expression is largely restricted to MITF

Low

/AXL

High

melanoma cells we

performed immunofluorescence to detect CAV1 in the IGR39

cell line used as a model for the BRAFi-resistant

undifferentiated phenotype. Under control conditions, CAV1 was excluded from nuclei, using Lamin B as a marker

for the nuclear periphery, and was found primarily in the cytoplasm or associated with the plasma membrane as

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

expected (Figure 3A). By contrast, exposure to oleic acid (OA) led to increased CAV1 expression and a proportion

of the protein exhibiting a nuclear localization. This observation was confirmed by Western blotting of fractionated

cell extracts (Figure 3B) that showed OA could induce elevated levels of cytoplasmic CAV1 as well as an increase

in nuclear CAV1. Nuclear accumulation of a proportion of CAV1, and its interaction with the inner nuclear

membrane protein emerin, has been noted previously(Chretien et al., 2008; Sanna et al., 2007), though the trigger

for nuclear localization of CAV1 and its consequences had not previously been deciphered.

CAV1 can interact with

-catenin (Conde-Perez

et al.

, 2015), whose activity is primarily promoted by WNT

signaling

(Clevers, 2006)

, together with glucose-driven

-catenin acetylation that promotes its nuclear

accumulation and regulation of its target genes (Chocarro-Calvo et al., 2013).

-catenin plays a key role in the

melanocyte lineage by driving the genesis of melanoblasts in the neural crest

(Sommer, 2011)

, activating

melanocyte stem cells

(Rabbani et al., 2011),

suppressing melanoma senescence (Delmas et al., 2007), and

promoting melanoma proliferation (Widlund et al., 2002) and metastasis (Damsky et al., 2011). The cytoplasmic

interaction between

-catenin and CAV1 is inhibited by PTEN, a suppressor of PI3K, (Conde-Perez

et al.

, 2015),

that is mutated in IGR39 cells. Therefore, we asked whether oleic acid could control CAV1-

-catenin interaction

to mediate their nuclear translocation.

Significantly, 4 h after addition of oleic acid we noted an increase in

-catenin nuclear localization in IGR39

cells both by immunofluorescence (Figure 3C), and by Western blotting of fractionated extracts using GAPDH

and TBP as markers of the cytoplasmic and nuclear fractions respectively (Figure 3D). The ability of OA to

promote nuclear localization of

-catenin in the MITF

Low

IGR39 cell line was similar to that of LiCl (Supplemental

Figure S2A), that prevents

-catenin degradation by inhibiting GSK3. Significantly, in CAV1-negative IGR37

cells, OA had no effect on

-catenin nuclear accumulation, whereas LiCl both increased

-catenin levels and

nuclear location (Supplemental Figure S2B). The results obtained using immunofluorescence of IGR37 cells were

confirmed by western blotting of fractionated cell extracts (Supplemental Figure S2C). Importantly, in IGR39 cells

LiCl induced the inhibitory GSK3

phosphorylation on S9, but oleic acid did not (Supplemental Figure S2D),

indicating that the mechanism underlying nuclear localization of

-catenin in response to oleic acid was not

mediated by inhibition of GSK3

. Nor did we detect any change in phosphorylation of Y279 or Y216 on

GSK3

and GSK3

respectively

modifications that facilitate activation of the WNT-

-catenin pathway (Gao et

al., 2015). We also noted no significant change in

-catenin mRNA levels in response to oleic acid (Supplemental

Figure S2E).

Consistent with OA triggering nuclear localization of

-catenin, exposure of IGR39 cells to oleic acid for 4 h

led to a 5-fold transcriptional activation of the SuperTOP-flash reporter

(Veeman et al., 2003)

(Figure 3E, left

panel) containing canonical

-catenin-LEF/TCF response elements, compared to the non-responsive mutant

variant (SuperFOP-flash). As a positive control we used LiCl, that at 24 h increased the

-catenin-responsive TOP

-flash reporter by almost 4-fold compared to the non-responsive FOP-flash reporter. Unlike the IGR39 cells, using

the MITF

High

IGR37 cell line we failed to see any significant effect of oleic acid on the TOP-flash reporter at 4 h

or 24 h, while a robust activation of the reporter was noted 24 h after addition of LiCl (Figure 3E right panel).

Thus, the transcriptional response of cells to oleic acid was phenotype specific.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

We next asked whether oleic acid could affect

-catenin nuclear accumulation via promoting an association

with CAV1. Co-immunoprecipitation of nuclear extracts using an anti-

-catenin antibody revealed that oleic acid

led to increased interaction between

-catenin and CAV1 in the nuclear fraction (Figure 3F). Significantly, CAV1-

specific siRNA prevented oleic acid-mediated nuclear accumulation of

-catenin (Figure 3G). Collectively these

data suggest that oleic acid triggers formation of a

-catenin-CAV1 complex, and that CAV1 is necessary for oleic

acid-induced nuclear translocation and activity of

-catenin. Since CAV1 is only expressed in the

MITF

Low

/AXL

High

undifferentiated cells, these observations uncover a phenotype specific molecular response to

oleic acid.

Oleic acid-mediated activation of SRC promotes CAV1 and

-catenin nuclear localization

Transcriptional activity of

-catenin requires its phosphorylation by SRC at Y333 (Yang et al., 2011).

Whether oleic acid could induce

-catenin phosphorylation through SRC activation in IGR39 cells is unknown.

To investigate this, cells were treated with oleic acid and

-catenin phosphorylation probed by western blotting

using a pY333 antibody. The results revealed that oleic acid induced robust phosphorylation of

-catenin at Y333

(Figure 4A). We also noted that oleic acid induced phosphorylation of CAV1 at Y14 (Figure 4B), also a known

SRC phosphorylation site (Li et al., 1996) previously implicated in melanoma cell invasion

(Ortiz et al., 2016), as

well as increasing CAV1 levels.

These data suggest that oleic acid may induce activation of SRC in IGR39

melanoma cells. We therefore assessed the effect of oleic acid over time on both phosphorylation of CAV1 Y14,

and on SRC phosphorylation at Y416 that stimulates SRC kinase activity by stabilizing its activation loop. pY416

SRC is frequently used as a surrogate measure of SRC activity (Kmiecik et al., 1988). The results, (Figure 4C)

revealed that phosphorylation of CAV1 Y14 increases over time following exposure of cells to oleic acid, starting

at 30 min to 1 h. Similarly, within 30 minutes oleic acid induces the activating Y416 phosphorylation of SRC that

is maintained over 24 h. We further confirmed that oleic acid mediates activation of SRC by examining

phosphorylation of STAT3 Y705, another well-characterized SRC target

(Cao et al., 1996).

The results (Figure

4C, lower panels) revealed that the increase in SRC Y416 over time induced by oleic acid was paralleled by

elevated STAT3 Y705 phosphorylation. Significantly, the activation of SRC by oleic acid was reproduced in an

alternative MITF

Low

undifferentiated melanoma cell line, WM793 (Figure 4D). By contrast, no SRC activation

was detected in the MITF

High

line IGR37. Consistent with SRC phosphorylating CAV1, treatment of IGR39 cells

with the SRC family inhibitor PP2 abolished the phosphorylation of CAV1 at Y14 (Figure 4E) as well as reducing

CAV1 levels.

The requirement of OA-induced SRC activation for CAV1-

-catenin complex formation and nuclear

localization was tested by inhibition or depletion of SRC. Immunofluorescence revealed that inhibition of SRC

family kinases using PP2 not only blocked the oleic acid-dependent increase in nuclear CAV1, but also prevented

the nuclear accumulation of

-catenin (Figure 4F). This result was confirmed using Western blotting (Figure 4G),

that showed that the oleic acid-induced nuclear accumulation of both CAV1 and

-catenin was blocked using PP2.

Notably overexpression of WT CAV1, but not a Y14F non-phosphorylatable mutant, was able to promote nuclear

accumulation of

-catenin, mimicking the effect of oleic acid (Figure 4H).

As these results were obtained using free oleic acid, we next ascertained whether the bi-directional

interaction between melanoma cells and human adipose tissue explants could recapitulate the observations. The

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

results revealed that like oleic acid, exposure of IGR39 cells to human adipose tissue explants led to activation and

phosphorylation of SRC and downstream phosphorylation of CAV1 Y14 and

-catenin Y654 (Figure 4I).

Oleic acid activates AXL

Taken together the data so far reveal that undifferentiated MITF

Low

melanoma cells, but not MITF

High

cells, induce

lipolysis in human adipose tissue explants, and that FATP-independent fatty acid uptake by the melanoma cells

triggers a cascade of events including activation of SRC leading to formation and nuclear translocation of a CAV1-

-catenin complex. However, even though both MITF

High

IGR37 and MITF

Low

IGR39 cells can take up free oleic

acid, SRC is only activated in MITF

Low

IGR39 cells.

Since SRC can be activated by receptor tyrosine kinase (RTK)-mediated phosphorylation, we considered

the possibility that oleic acid-induced SRC phosphorylation would be mediated through activation of an RTK

whose expression is restricted to MITF

Low

cells. One candidate was AXL, a key RTK whose expression has been

associated with resistance to therapy in melanoma (Konieczkowski

et al.

, 2014; Muller

et al.

, 2014) as well as

breast and other cancers (Auyez et al., 2021). Importantly, AXL is specifically expressed in MITF

Low

melanoma

cells (Figure 2E-G) and is normally activated by its ligand GAS6 that promotes its dimerization. Instead, we

considered the possibility that activation might also be achieved via exposure of cells to oleic acid. We initially

asked whether oleic acid would trigger autophosphorylation in trans of Y779, a marker of AXL activation. Western

blotting of the MITF

Low

AXL

High

WM793 melanoma cell line revealed that oleic acid induced elevated AXL Y779

phosphorylation, indicative of AXL activation, starting within 30 min of oleic acid addition (Figure 5A). In both

IGR39 and in WM793 cells, activation of AXL was reflected by elevated SRC phosphorylation (Figure 5B).

Importantly, the increase in SRC phosphorylation triggered by exposure to oleic acid in both IGR39 or WM793

was blocked by treatment with the AXL inhibitor ONO-7475 (Figure 5C). Inhibition of AXL using ONO-7475,

or a second inhibitor R428 (Bemcetinib), also prevented the induction of phosphorylation of CAV1 Y14 by Oleic

acid (Figure 5D). Thus oleic acid triggers a cascade of downstream events leading to nuclear localization of a

CAV1-

-catenin complex (Figure 5E).

Intriguingly, treatment of cells with the AXL inhibitors ONO-7475 or R428 decreased oleic acid uptake

into both IGR39 and WM793 melanoma cells (Figure 5F), as did inhibition of SRC with PP2 (Figure 5G). This is

consistent with oleic acid uptake in MITF

Low

melanomas being mediated by caveolae (Figure 2I, J) since CAV1

Y14 phosphorylation by SRC is necessary for caveolae-mediated endocytosis (Hau et al., 2019). The results also

reveal a potential positive feedback loop between oleic acid uptake and AXL activation.

Oleic acid-mediated activation of AXL drives melanoma invasiveness

Since AXL and SRC activation may drive invasion, we assessed whether OA could enhance invasion in

IGR39 cells. The results obtained using a Matrigel transwell assay revealed that OA induced a robust increase in

invasion in MITF

Low

IGR39 cells, but not in MITbodipyF

High

IGR37 cells (Figure 6A). Similar results were

obtained using human adipose tissue explants that in co-culture induced invasion in IGR39, but not IGR37 cells

(Figure 6B). siRNA-mediated depletion of either CAV1 or

-catenin (Figure 6C) inhibited OA-induced invasion

(Figure 6D). Importantly, the OA-mediated increase in invasion by IGR39 cells was also prevented using two

different AXL inhibitors, ONO-75475 or R418 (Figure 6E).

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Discussion

It is now widely appreciated that tumors contain multiple phenotypically distinct populations of cancer cells

that differ in their biological properties, some of which contribute to therapy resistance and metastatic

dissemination. Yet whether specific phenotypic states might mediate unique bi-directional interactions with the

microenvironment is not well understood. Here we reveal a previously unsuspected ability of oleic acid, a widely

available microenvironmental fatty acid, to activate AXL, a phenotype-restricted RTK implicated in therapy

resistance. OA-driven activation of AXL leads to downstream SRC signalling, nuclear localization of a complex

between CAV1 and

-catenin, a key melanocyte and melanoma effector protein, and increased invasion.

In many cancer types AXL expression has been associated with an epithelial to mesenchymal (EMT) transition

and invasiveness

(Asiedu et al., 2014; Boshuizen et al., 2018; Shao et al., 2023; Wang et al., 2016) and

is linked

to worse prognosis and resistance to therapies in a wide range of cancers including prostate

(Bansal et al., 2015)

breast

(Creedon et al., 2014)

, lung

(Zhang et al., 2012)

, renal

(Zhou et al., 2016)

, head and neck

(Elkabets et al.,

2015)

and neuroblastoma

(Debruyne et al., 2016)

. Consequently, AXL has attracted increasing attention as a

candidate for therapy

(Auyez

et al.

, 2021; Colavito, 2020; Gay et al., 2017)

. In melanoma, high AXL is specifically

expressed in undifferentiated and invasive phenotype phenotype cells and is commonly associated with therapy-

resistance

(Konieczkowski

et al.

, 2014; Muller

et al.

, 2014; Rambow

et al.

, 2018)

as well as resistance to immune

checkpoint inhibition

(Hugo et al., 2016)

. As a consequence, targeting AXL can eliminate specific subpopulations

of melanoma cells and can cooperate with inhibition of the MAPK pathway

(Boshuizen

et al.

, 2018)

. Importantly,

rather than AXL expression simply acting as a marker of therapy resistance and EMT, in pre-clinical models

targeting AXL can sensitize tumors to therapies

(Auyez

et al.

, 2021).

This suggests that to promote therapy

resistance and to exert its pro-survival and pro-metastasis effects, AXL should be activated by its ligand GAS6,

which is widely expressed by cancer cells, stromal cells and infiltrating immune cells

(Auyez

et al.

, 2021)

Alternatively, as we show here, AXL can also be activated by oleic acid, triggering downstream activation of SRC.

Our results therefore highlight a way in which the availability of a key nutrient can differentially impact distinct

classes of melanoma cells via ligand-independent activation of an RTK with major consequences for disease

progression. This is important as AXL is expressed on invasive and undifferentiated phenotype cells that may

escape tumors to enter the lymphatic or blood vessels, or invade other tissues where GAS6 may not be abundant.

Under these circumstances, an alternative pathway to activating AXL will provide a critical selective advantage.

For example, oleic acid that is the major circulating free fatty acid in tumor associated lymph

(Morfoisse et al.,

2021),

including in melanoma

(Ubellacker

et al.

, 2020)

, and which can be released from adipocytes in proximity

to melanoma cells

(Zhang

et al.

, 2018)

, may promote survival and maintenance of an invasive state via AXL

signaling. Moreover, as activation of SRC is a pro-survival signal triggered by integrin-interactions with

extracellular matrix that has been linked to BRAFi-resistance in vivo

(Hirata et al., 2015)

, it is plausible that the

ability of oleic acid to promote SRC activation via AXL provide a degree of adhesion mimicry that would suppress

cell death in non-attached, metastasizing cancer cells. In this respect, the expression of AXL on therapy resistant

cells in a wide variety of cancers known to invade or metastasize to adipose tissue

(Hoy

et al.

, 2021)

or via the

lymphatic system may provide a key pro-survival mechanism that extends well beyond the ability of some fatty

acids, such as palmitate

(Altea-Manzano et al., 2023)

, to promote proliferation via fatty acid oxidation.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

In addition to fatty acid uptake from lymph or through melanoma induced lipolysis in adjacent adipocytes, the

activation of AXL by oleic acid may also have implications for our understanding of the impact on cancer

progression of obesity, a known risk factor for many cancers including melanoma

(García-Jiménez et al., 2016)

Obesity is associated with elevated plasma free fatty acid (FFA) levels

(Henderson, 2021)

. As a consequence, the

elevated availability of FFAs in obese individuals will increase the probability of activation of AXL and its

downstream signaling in MITF

Low

melanoma cells, promoting survival, increased invasiveness and metastatic

dissemination as well as therapy resistance. Consistent with this, mice fed a high fat diet exhibit increased

melanoma progression associated with elevated

Cav1 as well as pCav1

(Pandey et al., 2012)

Beyond activation of AXL our results provide three additional and unanticipated insights. First, we show that

unexpectedly, only MITF

Low

, undifferentiated melanoma cells, and not MITF

High

cells, are competent to induce

lipolysis in human adipose tissue explants; second, in contrast to MITF

High

cells, uptake of oleic acid by MITF

Low

melanoma cells does not appear to involve lipofermata-sensitive FATPs or CD36; and third, our results highlight

the phenotype specific effect of oleic acid in promoting, via activation of AXL and SRC, nuclear translocation of

a CAV1-

-catenin complex. These observations have profound implications for our understanding of how

bidirectional interactions with adipocytes in vivo may shape disease progression.

The observation that MITF

Low

, but not MITF

High

, melanoma cells can induce lipolysis in, and lipid uptake from,

human adipose explants was unexpected. However, this observation is entirely in keeping with the hypothesis that

MITF

Low

cells are invasive because they lack, or fail to sense, key nutrients that are needed to support log-term

survival

(García-Jiménez and Goding, 2019)

. For example, as MITF activates transcription of the key fatty acid

desaturase SCD, MITF

Low

cells express low levels of SCD and exhibit an increased saturated to mono-unsaturated

fatty acid ratio, an imbalance that can stabilise an invasive state (Vivas-Garcia

et al.

, 2020). Therefore, it makes

sense for invasive MITF

Low

cells to try to redress this imbalance by acquiring fatty acids from adipocytes.

However, while lipid release may be triggered by invasive MITF

Low

cells, it does not mean they will revert to a

proliferative state which would require both the carbon provided by fatty acids, but also nitrogen (amino acids) to

fuel protein synthesis. Thus, lipolysis and fatty acid uptake may increase invasion to enable cells to maintain their

search for a niche suitable to promote proliferation.

Why MITF

High

phenotype cells use FATPs to take up fatty acids, while uptake in MITF

Low

cells is FATP

independent is unclear. As FATPs have been found in species from bacteria and yeast to man

(Doege and Stahl,

2006)

, it might have been expected that all cells would use FATPs to transport fatty acids. One possible explanation

for this phenotype-specific difference, is that undifferentiated MITF

Low

cells tend to be slow cycling and would

have reduced demands for energy and the building blocks, especially membranes, required to generate daughter

cells compared to more rapidly dividing MITF

High

cells. It is plausible therefore that the need for long-chain fatty

acids (LCFAs) by slow cycling MITF

Low

cells can be met by non-FATP-mediated transport, but in proliferative

MITF

High

cells the high demand for LCFAs requires efficient transport by FATPs. This hypothesis would be

consistent with the recent observation that the melanocytic state, associated with MITF

High

-driven differentiation,

is characterized by increased uptake of oleic acid, and accumulation of lipid droplets

(Lumaquin-Yin

et al.

, 2023)

Importantly, the observation that MITF

Low

cells use a FATP-independent mechanism for fatty acid uptake has

significant implications for the therapeutic use of anti-cancer strategies that propose the use of FATP or CD36

inhibitors as an effective anti-cancer strategy

(Alicea

et al.

, 2020; Pascual

et al.

, 2016; Zhang

et al.

, 2018)

;

MITF

Low

cells would be resistant to such inhibitors as they are to many other drugs including BRAF inhibitors.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Notably, previous work has failed to identify a nuclear localization signal in

-catenin, meaning that its nuclear

localization presumably arises through regulated interaction with cofactors. Here, we reveal that oleic acid

activates a novel AXL, SRC and CAV1-dependent mechanism that can promote nuclear localization of

-catenin

independent of addition of WNT, the canonical trigger for

-catenin nuclear accumulation. Although previous

work has shown cytoplasmic

-catenin-CAV1 interaction in the absence of PTEN (Conde-Perez

et al.

, 2015),

neither the ability of this complex to translocate to the nucleus, nor the regulation of

-catenin-CAV1 complex

formation by an oleic acid/AXL/SRC axis, was known. Significantly, the ability of OA to drive nuclear

translocation of

-catenin is restricted to MITF

Low

melanoma cells, since only the neural crest-like and

undifferentiated phenotypes express CAV1 and AXL whose expression we find is highly correlated in melanoma

cells as well as in other cancer types.

In summary, we reveal here a phenotype specific ability of de-differentiated cancer cells to induce fatty acid

release from human adipocytes that are then taken up via a non-FATP mechanism to promote activation of AXL,

SRC and

-catenin signalling to drive increased invasion and metastatic potential.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

KEY RESOURCES TABLE:

REAGENT or RESOURCE

SOURCE

IDENTIFIER

RRID

Antibodies

Rabbit Monoclonal anti-AXL (C89E7)

Cell Signaling

Cat# 8661

AB11217435

Rabbit polyclonal anti-phospho-Axl (Tyr779)

Cell Signaling

Cat# 96453

Rabbit polyclonal anti-phospho-

Catenin (Y654)

Abcam

ab59430

AB_940822

Rabbit polyclonal anti-phospho-

Catenin (Y333)

Abcam

ab194797

Mouse monoclonal anti-

-CATENIN

BD Transduction
Laboratories

Cat# 610154

AB_563467

Rabbit polyclonal anti-Caveolin-1

Cell Signaling

Cat#3238

AB_2072166

Mouse monoclonal Anti-Caveolin-1 antibody [7C8]

Abcam

ab17052

AB_443609

Rabbit polyclonal anti-Phospho-Caveolin-1 (Tyr14)

Cell Signaling

Cat#3251

AB_2244199

Rabbit polyclonal anti-Phospho-Caveolin-1 (Tyr14)

BD Transduction
Laboratories

Cat#611339

AB_398863

Rabbit polyclonal anti-ERK (C14)

Santa Cruz
Biotechnology

Cat#SC-154

AB_2141292

Mouse monoclonal anti-GAPDH

Sigma-Aldrich

Cat# G8795

AB_627679

Rabbit polyclonal anti-Phospho-GSK-3

(Ser9)

Cell Signaling

Cat # 9336

AB_331405

Rabbit polyclonal anti-Phospho-GSK3B (Tyr216, Tyr279) Thermo Fisher

Scientific

Cat#44604G

AB_2533691

Mouse monoclonal anti-GSK-3

BD Transduction
Laboratories

Cat# 610201

AB_397600

Rabbit polyclonal anti- Phospho-HSL (Ser660)

Cell Signaling

Cat # 45804

AB_2893315

Rabbit monoclonal anti-HSL (D6W5S) XP

Cell Signaling

Cat # 18381

AB_2798800

Rabbit polyclonal anti-Lamin B

Invitrogen

Cat#702972

AB_2784553

Mouse monoclonal anti-MITF

Abcam

Ab12039

AB_298801

Mouse monoclonal anti-MYC tag

Cell Signaling

Cat#2276

AB_331783

Rabbit monoclonal anti-Perilipin-1 (D1D8) XP

Cell Signaling

Cat #9349

AB_10829911

Rabbit monoclonal anti-Phospho-Src (Tyr416) (D49G4)

Cell Signaling

Cat#6943

AB_10013641

Rabbit monoclonal anti- Src (36D10)

Cell Signaling

Cat#2109

AB_2106059

Rabbit monoclonal anti-Phospho-Stat3 (Tyr705) (D3A7) Cell Signaling

Cat# 9145

AB_2491009

Mouse monoclonal anti-STAT 3

Cell Signaling

Cat#9139

AB_331757

Mouse Monoclonal anti-

-Tubulin

Sigma

Cat# T5168

AB_477579

Rabbit Polyclonal TFIID-TBP (N12)

Cell Signaling

Cat#44059

AB_2799258

Goat Anti-Rabbit IgG (H+L) HRPO

BIO-RAD

Cat #170-6515 AB_11125142

Goat Anti-Mouse IgG (H+L) HRPO

BIO-RAD

Cat #170-6516 AB_11125547

Rabbit-Anti Goat IgG (H+L) HRPO

BIO-RAD

Cat #172-1034 AB_11125144

Donkey Anti-Rabbit- AlexaFluor488

Invitrogen

A21206

AB_141708

Goat Anti-Mouse- AlexaFluor405

Abcam

ab175660

AB_2885184

Donkey Anti-Goat-AlexaFluor647

Invitrogen

A21447

AB_2535864

Donkey Anti-Rabbit-AlexaFluor647

Invitrogen

A31573

AB_2536183

Bacterial and Virus Strains

Subcloning Efficiency DH5

bacteria

New England
Biolabs

NEB5

Chemicals, Peptides, and Recombinant Proteins

RPMI 1640 media

Corning

Cat# 5510-
041-cv

M199 medium

LONZA

Cat# BE12-
117F

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Pre-Adipocyte growth medium

Sigma

Cat# D5796

IBMX

Sigma

Cat# I7018

Insulin

Sigma

Cat# I5500

L-Glutamine (200 mM)

LONZA

Cat# BE17-
605E

Penicillin-Streptomycin

LONZA

Cat# DE17-
602E

MEM NEAA

GIBCO

Cat# 11140-
035

Fetal Bovine Serum

Sigma

Cat# F7524

Dexamethasome

Sigma

Cat# D5796

Oleic acid

Sigma

Cat#O1383

Palmitic acid

Sigma

Cat#P0500

Lithium cloride

Sigma

Cat#L9650

Lipofermata

Cayman chemical Cat#25869

Nystatin

Deltaclon

Cat#S1934

PP2

Deltaclon

Cat#S7008

ONO-7475

Deltaclon

Cat#S8933

R428 (Bencentinib)

Deltaclon

Cat#S2841

Recombinant Human/Mouse Wnt-5a Protein

R&D Systems

Cat#: 645-WN

Bradford

Sigma

Cat#B6916

BSA

Sigma

Cat#A7906

Nile Red

Sigma

Cat#N3013

BODIPY™ 493/503

Invitrogen

Cat#D3922

Oil Red O

Sigma

Cat# O9755

DAPI (4',6-diamidino-2-fenilindol, dilactato)

Invitrogen

Cat#D3571

Hoechst 33258

Life Tech

Cat#H3569

Protease inhibitor Cocktail

Roche

Cat#04693132
001

JetPei PolyPlus reagent

Genycell Biotech

Cat# 101-10N

JetPrime PolyPlus reagent

Genycell Biotech

Cat # 114-01

DYNAbeads Protein A

Invitrogen

Cat # 10002D

DYNAbeads Protein G

Invitrogen

Cat # 10004D

High density PET Permeable Support

Falcon

Cat #
45353092

Corning Matrigel Invasion Chamber

Corning

Cat #
45354480

Critical Commercial Assays

Clarity ECL detection kit

BIO-RAD

Cat#170-5060

RNA extraction rNeasy Mini Kit QIAGEN

QIAGEN

Cat#74106

QIAGEN

Cat#74106

Dual-Luciferase reporter Assay System

Promega

Cat#E1960

Pierce BCA Protein Assay Kit

ThermoFisher

Cat#23225

IGR39 (Male). Human melanoma cell line.

Obtained from
Luisa
Lanfrancone

(Aubert et al.,
1980)

IGR37 (Male). Human melanoma cell line.

Obtained from
Luisa
Lanfrancone

(Aubert

et al.

1980)

501mel (Female). Human melanoma cell line

Obtained from
Ruth Halaban,
Yale

(Zakut et al.,
1993)

sKmel28 (Male). Human melanoma cell line

Obtained from
ATCC

(Fogh et al.,
1977)

CVCL_2076

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

WM278 (Female). Human melanoma cell line

Obtained from
Meenhard Herlyn

(Herlyn et al.,
1985)

CVCL_2075

WM115 (Female). Human melanoma cell line

Obtained from
Meenhard Herlyn

(Herlyn

et al.

1985)

CVCL_4633

WM226.4 (Female). Human melanoma cell line

Obtained from
Meenhard Herlyn

(Herlyn

et al.

1985)

CVCL_0526

WM793 (Male). Human melanoma cell line

Obtained from
Meenhard Herlyn

(Herlyn

et al.

1985)

CVCL_6473

CHL-1 (Female). Human melanoma cell line

Obtained from
Meenhard Herlyn

Cashion L.,
1991

CVCL_0040

A375M (Male). Human melanoma cell line

Obtained from
ATCC

(Fogh

et al.

1977; Giard et
al., 1973)

CVCL_2765

3T3-L1 Mouse fibroblast cell line

ATCC

CVCL_8787

Oligonucleotides

CVCL_1122

Human

CTNNB1

RT qPCR primers

F 5´-3´: GTGCTATCTGTCTGCTCTAGT
R 5´-3´: CTTCCTGTTTAGTTGCAGCATC

Sigma

This Study

CVCL_B222

Human 18S RT qPCR primers

F 5´-3´: AGTCCCTGCCCTTTGTACACA

R 5´-3´: GCCTCACTAAACCATCCAATCG

Sigma Aldrich

This Study

CVCL_0123

siRNA Human caveolin-1

Santa Cruz
Biotechnology

SC-29241

siRNA Human c-Src

Santa Cruz
Biotechnology

SC-29228

SMARTpool: ON-TARGETplus SRC siRNA

Dharmacon Inc

L-003175-00-
0005

siRNA

-Catenin

r(UCCAUUCUGGUGCCACCAC)d(TT)
r(GUGGUGGCACCAGAAUGGA)d(TT)

Qiagen

This Study

Negative Control siRNA

Qiagen

Cat# 1027281

Human Caveolin-1 subcloning primers
F 5’-3’:
CGCGGATCCGTGAACCGTCAGATCCGCTAG
R 5’-3’:
GCTCTAGAGCCTGCAAGTTGATGCGGACATTG

Sigma

This Study

Recombinant DNA

Super8XTOPFlash

Obtained from R.
Moon

(Veeman

al.

, 2003)

Super8XFOPflash

Obtained from R.
Moon

(Veeman

al.

, 2003)

pcDNA3.1-Caveolin-1 WT-Myc-His

This study

N/A

pcDNA3.1-Caveolin-1 Y14F-Myc-His

This study

N/A

Addgene_12456

Software and Algorithms

Addgene_12457

LAS AF software

Leica

SP5

Glo-Max 96 Multidetection system

Promega

N/A

GraphPad Prism software

GraphPad
Software

https://www.g
raphpad.com

ImageLab

Bio-Rad

ChemiDoc
XRS+ System

SCR_013673

CXP software

Becton-
Dickinson

FACSCalibur

ImageJ software

N/A

https://imagej.
nih.gov/ij/dow
nload.html

SCR_002798

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

RNAseq data

cBioportal

http://www.cb
ioportal.org

SCR_014210

Molecular Signatures

mSigDB

http://www.br
oadinstitute.or
g/msigdb

SCR_016722

Other

SCR_003070

TCGA analysis R-script

N/A

(Riesenberg et
al., 2015)

SCR_014555

METHODS

Cell lines

All human melanoma cell lines were cultured in RPMI supplemented with 10% fetal bovine serum (FBS)

plus 1% penicillin–streptomycin and maintained in 5% CO

environment at 37ºC. All the cell lines were

tested monthly for mycoplasma and subject to authentication by short tandem repeat (STR) profiling.

RNAi gene silencing

Cells plated in six well plates at 50% confluence were transfected with siRNA using JetPRIME Polyplus

reagent (Genycell Biotech, Santa Fe, Granada, Spain), following the manufacture’'s instructions. After

2 days cells were treated and collected to perform invasion assay or to be analysed by western blot.

Specific siRNA oligonucleotides for

-catenin and control siRNA were obtained from Qiagen,

Caveolin-1, and SRC siRNA from Santa Cruz Biotechnology and SRC siRNA Dharmacon Inc.

Plasmid subcloning

Caveolin-1 WT or Y14F were subcloned from CAV1-mRFP plasmid

(Tagawa et al., 2005)

by PCR

amplification with the indicated primers (Key Resources table) followed by a digestion with Bam HI

and Xba I enzymes (New England Biolabs) for 37ºC 2 h. The fragments were gel-purified with a kit

(Qiagen, Crawley, UK) were cloned into pcDNA3.1-myc-His plasmid (Promega). For sequencing we

used a sequence analyser (ABI Prism 3100 Avant; Applied Biosystems, Alcobendas, Madrid, Spain.

The correct introduction of the fragment was evaluated by plasmid sequencing using the BigDye Cycle

Sequencing Kit (Applied Biosystems).

Transient transfections

Cells were seeded in plates at 50% confluence and transfected using JetPei PolyPlus reagent (Genycell

Biotech, Santa Fe, Granada, Spain), following the manufacturer’s instructions. After 36 h cells were

treated as indicated and collected to analyse by western blot or immunofluorescence.

Preparation of cell extracts

Whole cell extracts.

Cells were washed with iced PBS before extract preparation and scraped in RIPA

buffer (10 mM Tris.HCl pH 7.4, 5 mM EDTA, 5 mM EGTA, 1% Triton X100, 10 mM Na

, pH

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

7.4, 10 mM NaF, 130 mM NaCl, 0.1% SDS, 0,5% Na-deoxycholate). After 5 min on ice, cells were

pelleted (12,000 rpm for 5 min, 4ºC) and the supernatant was directly used as whole cell extract or frozen

at -80 ºC.

Fractionated cell extracts.

After washing as before, cells were scraped in hypotonic buffer (20 mM

Hepes, pH 8.0, 10 mM KCl, 0.15 mM EDTA, 0.15 mM EGTA, 0.05% NP40, and protease inhibitors)

and swollen on ice for 10 min before adding 1:2 vol of sucrose buffer (50 mM Hepes, pH 8.0, 0.25 mM

EDTA, 10 mM KCl, 70% sucrose). Lysates were fractionated (5,000 rpm for 5 min at 4ºC) to obtain the

cytoplasmic fraction in the supernatant. Nuclear pellets were further washed twice with washing buffer

(20 mM Hepes, pH 8.0, 50 mM NaCl, MgCl

1.5 mM, 0.25 mM EDTA, 0.15 mM EGTA, 25% glycerol

and protease inhibitors), pelleted at 5,000 rpm, 5 min at 4ºC and resuspended in nuclear extraction buffer

(20 mM Hepes, pH 8.0, 450 mM NaCl, MgCl

1.5 mM, 0.25 mM EDTA, 0.15 mM EGTA, 0.05% NP40,

25% glycerol and protease inhibitors) before centrifugation at 12,000 rpm for 5 min at 4ºC to pellet and

discard cell debris. The supernatants were used as nuclear fractions.

Immunoprecipitation.

Whole cell extracts were obtained in the same buffer without 0.1% SDS and 0,5% Na-deoxycholate.

For immunoprecipitation from fractionated extracts the hypotonic buffer was modified by adding 100

mM NaCl and 0.1% NP40. For immunocomplex formation, protein A/G-coated magnetic beads were

washed 3 times with the extraction buffer before coating with the primary antibody for 2 h at 4 ºC in a

rotating wheel, followed by 2 washes with the same buffer to eliminates unbound antibody and then

extracts are added O/N at 4ºC in the rotating wheel. Immunocomplexes were washed twice and used for

western blotting.

Western blot

Protein lysates were subjected to 7.5 or 10% polyacrylamide SDS- PAGE. Proteins were transferred

onto polyvinylidene difluoride membranes. Membranes were blocked with 5% nonfat milk or bovine

serum albumin in TBS containing 0.1% Tween 20 and probed with the appropriate primary antibodies

(see Key Resources Table) overnight at 4°C. The specific bands were analyzed using ChemiDoc

Imaging Systems (Bio-Rad).

Immunofluorescence microscopy

Cells in cover slips were washed three times and fixed with 4% paraformaldehyde in PBS, pH 7.4 for

10 min; washed again; permeabilized (PBS pH7.4, 0.5% Triton X-100, 0.2% BSA) for 5 min; blocked

(PBS pH7,4, 0,05% Triton X-100, 5% BSA) for 1 h at room temperature; incubated with primary

antibody over night at 4ºC, washed three times for 5 min and incubated with the secondary antibody for

1 h at room temperature. For lipid staining after antibody incubation, cells were washed twice with PBS

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

and stained with a solution containing 5 µg/mL BODIPY or Nile Red. After 30 min incubation at room

temperature, cells were washed twice with PBS. Slides were mounted and images were acquired using

a SP5 confocal microscope (Leica) with a 63x objective.

Luciferase reporter assay TOP/FOP reporter Luciferase activity.

Melanoma cells seeded in 24-weel plates at 50% confluence were co-transfected with 125ng of the

indicated promoter reporter and 25ng of Renilla luciferase construct, for normalization of transfection

efficiency, using JetPei PolyPlus reagent (Genycell Biotech, Santa Fe, Granada, Spain), following the

manufacturer’s instructions. Forty-eight hours after transfection, cells were treated with 100

M oleic

acid (OA) or 20mM lithium chloride for another 4 or 24 hr. Cells were lysed, and luciferase activity was

measured in triplicate using the dual luciferase reporter kit (Promega) and a Glo-Max 96 Multidetector

system (Promega). A minimum of 3 experiments were performed per cell line.

Crystal violet staining and cell density quantification

30,000 cells were plated in a 12-well plate and treated with DMSO, and oleic acid (100

simultaneously over 5-7 days as indicated. Thee medium was replaced every 3 days. Plates were

collected at time 0, 24, 72, 96 or 120 h, fixed with 4% PFA and stained with 0.1% crystal violet for 15-

30 min. Then they were washed and dried. Crystal violet was resuspended methanol), transferred to p96

plates and analysed by a Spectra FLUOR (Tecan) at 570 nm. Viability was measured in duplicate in

four independent experiments.

3T3-L1 co-culture experiments

3T3-L1 cells (

70,000 cells/well - 12 well plate

) were grown to 100% confluency in preadipocyte Growth

media (

High glucose DMEM (Sigma D5796)

;

10% Newborn Calf Serum (Sigma 12023C); 1%

Penicillin/Streptomycin (Sigma P0781); 1% L-Glutamine (Sigma G7513

). When cells reached

confluence, the medium was changed, and two days later differentiation was initiated. At day 0,

differentiation medium with full induction cocktail was added (

High Glucose DMEM (Sigma D5796);

10% FBS;

1% Penicillin/Streptomycin;

1% L-Glutamine

;

Induction cocktail:

0.5 mM IBMX (Sigma I7018);

1 µM Dexamethasome (Sigma D1881); 5 µg/ml Insulin (Sigma I5500). At Day 3, the medium was
changed to

differentiation media containing only Insulin (

5 µg/ml) for 72 h. At day 6, once

mature

adipocytes were obtained,

the medium was changed to simple

differentiation media to preserve their

adipocyte differentiated state. Differentiated adipocytes were used for all co-culture experiments.

For lipid transfer experiments, differentiated 3T3-L1 cells were preloaded with 1.5

M BODIPY-

FL-C16 in differentiation media (FBS+insulin) for 4 h, and then washed 2x by using PBS+ 0.1%

BSA-

free fatty acid. After 24 h, the preloaded adipocytes were washed again with PBS+ 0.1% BSA-free fatty

acid, and placed in co-culture with melanoma cells that had been seeded 24 h earlier in the trans-well

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

chambers. The adipocytes were located at the bottom, the melanoma cells on top, and maintained for 24

h in DMEM with 0.1% BSA-free fatty acid and without FBS. After 24 h in co-culture, melanoma cells

were washed and fixed with 4% PFA. For picture acquisition, the trans-well membranes were cut,

stained with DAPI and mounted in coverslips.

Adipose tissue and melanoma cell co-culture experiments

Adipose tissue human samples were derived from surgical removal at Hospital Universitario Fundación

Alcorcón (HUFA). Immediately after surgery adipose tissue was place into Medium 199 (M199) (Lonza)

with penicillin (100 U/l), and streptomycin (100 µg/ml), at room temperature. Blood vessels and

connective tissue was removed and uniform-sized tissue pieces of ~2 mm3 were dissected.

For co-culture experiments 48h before performing the co-culture experiments melanoma cells were

seeded at 50% confluence in a six well plate and adipose tissue pieces were cultured with melanoma

cell medium. To perform fat-explant-melanoma co-culture experiments high density PET permeable

supports with 3.0 µm pore were used (Falcon). The insert was placed in the six well plate where

melanoma cells had previously been seeded and 4-5 pieces per well of adipose tissue were placed in the

top, 2ml medium of the indicated melanoma cell line was added. 48 hours later the fat and cells were

collected and analysed changes in invasion capacity or by WB or immunofluorescence. To test if

lipolysis was induced by Wnt5a melanoma IGR37 cells co-cultured with adipose were treated with

Wnt5a (50ng/ml) for 4 days. Fat was collected and analysed by WB.

Oil red O staining

Oil red O stock solution was prepared dissolving 0.5 g of oil red O (Sigma-Aldrich) in 100 ml

isopropanol for 1 h at 56ºC in a water bath. A working solution was prepared by mixing 30 ml of the

Oil red O stock solution with 20 ml of distilled water, allowing to stand for 10 mins, and then filtering.

Cells in cover slips were washed three times and fixed with 4% paraformaldehyde in PBS, pH 7.4 for

10 min; briefly washed with running tap water, rinsed with 60% isopropanol, and stained with freshly

prepared Oil Red O working solution 15 mins. Then rinsed with 60% isopropanol, nuclei were stained

with hematoxylin for 1 min, rinsed with distilled water. Slides were mounted and images were acquired

using a Zeiss optical microscope with a 40x objective. Oil red O intensity was quantified using Image J

software. For each experiment, 3 different fields were evaluated per slide.

Matrigel invasion assays

Matrigel invasion assays were performed using invasion chambers from BD Biocoat 8

m membrane

inserts with Matrigel coating. 100,000 cells previously transfected and treated as indicated, or co-

cultured with adipose tissue explants were cultured in medium without 0.2% FBS overnight and seeded

per insert. Medium with 10% FBS was added to the bottom of the inserts. After 22 h of incubation,

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

chambers were fixed in 3.7% paraformaldehyde for 2 min, washed in phosphate-buffered saline (PBS),

stained with 1% crystal violet for 20 min and washed in phosphate-buffered saline (PBS). Cells

remaining above the insert membrane were removed by gentle scraping with a sterile cotton swab. Slides

were mounted and images were acquired using a Zeiss optical microscope with a 5x objective. Cells

were manually counted using ImageJ software. At least three biological replicates were performed.

RT-qPCR

Total RNA was isolated using the rNeasy minikit (Qiagen) or with Trizol (Invitrogen).

cDNA was

generated from 1 µg of RNA following the manufacturer’s protocol. Reactions were performed in SYBR

Green mix (Go-Taq, Promega) and analyzed using 7500 Fast Real-Time PCR System (Applied

Biosystems). Primers for human genes were designed using the Primer Blast application from NCBI

(see Key resources table). 18S ribosomal RNA and

-actin primers served as a nonregulated control.

Relative expression was calculated using the Ct method, expressed as 2

−ΔΔ

(Livak and Schmittgen,

2001).

The PCR efficiency was

∼

100%.

Statistical analysis

Results are presented as fold induction, mean ± SEM from at least three biological replicates.

Comparisons between two independent groups were performed with Mann-Whitney U-test. Tests for

significance between two sample groups were performed with Student’s t test and for multiple

comparisons, ANOVA with Bonferroni’s post-test.

RNA-seq

STR authenticated 21urofinss genomic service), mycoplasma free (Lonza #LT07-318, #LT07-518

(control) melanoma cell lines were seeded in 6 well tissue cultured dishes in RPMI 1640 (Gibco)

supplemented with 10% FBS (Biosera) and 100 U/ml Pen Strep (Gibco) and maintained in 10% CO

humidified chamber. Cells were collected at around 80% confluence and snap-freeze on dry ice before

batched processed using rNeasy Mini Kit (QIAGEN #74106) as per supplier instructions and eluted in

l nuclease free water (Invitrogen #10977049). Samples with RIN values

≥

9.5 (assessed using using

Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using

QuantSeq Forward kit (LEXOGEN #015.96) with 500 ng input material and ERCC ExFold RNA Spike-

In Mixes (ThermoFisher #4456739). Sequencing was carried out on a HiSeq4000 (Illumina) by the

Oxford Genomics Centre, Wellcome Trust Centre for Human Genetics.

Bioinformatics

Raw fastq reads for the same samples sequenced across 2 lanes were stitched using UNIX, qCed using

fastqc (v0.11.9), adaptor- and poly-A- trimmed using

Cutadapt

. Processed fastq were mapped against

hg38 (GRCh38, 2015) + ERCC STAR index using rna-star (v2.5.1b) with quantMode enabled, allowing

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

for soft-clipping and splicing (min 20 bp). Normalisation and differential gene expression analyses was

performed as previously described

(Louphrasitthiphol et al., 2020; Louphrasitthiphol et al., 2019; Vivas-

Garcia

et al.

, 2020)

using edgeR glmQLFTest. Heatmaps were visualised using R package pheatmap

(v1.0.12).

Gene expression from 53 melanoma cell lines (Tsoi

et al.

, 2018)

were obtained from GSE80829 and

their classification as per the original publication.

Gene expression data from the CCLE and TCGA were accessed through cBioportal

(Cerami et al., 2012;

Gao et al., 2013).

Moving average trendline of bar plot representing expression level of individual

samples was generated using a simple window size of 20. Spearman correlation and the significance

was calculated using cor.test function in R.

Data Availability

The authors declare that all data supporting the findings of this study are available within the article or

from the corresponding author upon request. The RNA seq data from the 12 in house melanoma cell

lines have been deposited on GEO (accession number: GSE184923 reviewer access token

yhcxcoicnnsflyl

)

Ethics Statement

Collection of human adipose tissue was performed according to IRB-HUFA, act number 17/68 granting

approval on June

h, 2017. Adipose tissue samples were collected using protocols approved by the

corresponding Ethics Committees and following the legislation. All patients gave written informed

consent for the use of their biological samples for research purposes. Fundamental ethical principles and

rights promoted by Spain (LOPD 15/1999) and the European Union EU (2000/C364/01) were followed.

All patients’ data were processed according to the Declaration of Helsinki (last revision 2013) and

Spanish National Biomedical Research Law (14/2007, July 3).

Acknowledgements

Funding was provided by the Ludwig Institute for Cancer Research (C.R.G, Y.V.G. and P.L.), NIH

grants PO1 CA128814-06A1 (Y.V.G., C.R.G.) and R01 CA268597-01 (C.R.G., P.L.), a European

Union Marie Curie Training Fellowship (FP7-PEOPLE: PIEF-GA-2013-626098) and European

Molecular Biology Organisation (EMBO) Long Term Fellowship (ALTF 800–2013) (A.C-C.), a

Ministerio de Economía y Competitividad Grant SAF2016-79837-R and Agencia Estatal de

Investigación MCIN/AEI/10.13039/501100011033 (PID2019-104867RB-I00) (C.G.J.) and PID2021-

127645OA-I00 (A.C-C); and Comunidad de Madrid PRECICOLON-CM, P2022/BMD-7212 (C.G.J.)

and Ayudas Atracción de Talento 2017-T1/BMD-5334 and 2021-5A/BMD-20951 (A.C-C).

Author Contribution

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

References

Alicea, G.M., Rebecca, V.W., Goldman, A.R., Fane, M.E., Douglass, S.M., Behera, R.,

Webster, M.R., Kugel, C.H., 3rd, Ecker, B.L., Caino, M.C., et al. (2020). Changes in Aged

Fibroblast Lipid Metabolism Induce Age-Dependent Melanoma Cell Resistance to Targeted

Therapy via the Fatty Acid Transporter FATP2. Cancer Discov.

, 1282-1295.

10.1158/2159-8290.CD-20-0329.

Altea-Manzano, P., Doglioni, G., Liu, Y., Cuadros, A.M., Nolan, E., Fernandez-Garcia, J., Wu,

Q., Planque, M., Laue, K.J., Cidre-Aranaz, F., et al. (2023). A palmitate-rich metastatic

niche enables metastasis growth via p65 acetylation resulting in pro-metastatic NF-kappaB

signaling. Nat Cancer. 10.1038/s43018-023-00513-2.

Anastas, J.N., Kulikauskas, R.M., Tamir, T., Rizos, H., Long, G.V., von Euw, E.M., Yang,

P.T., Chen, H.W., Haydu, L., Toroni, R.A., et al. (2014). WNT5A enhances resistance of

melanoma cells to targeted BRAF inhibitors. J Clin Invest

124

, 2877-2890.

10.1172/JCI70156.

Asiedu, M.K., Beauchamp-Perez, F.D., Ingle, J.N., Behrens, M.D., Radisky, D.C., and

Knutson, K.L. (2014). AXL induces epithelial-to-mesenchymal transition and regulates the

function of breast cancer stem cells. Oncogene

, 1316-1324. 10.1038/onc.2013.57.

Aubert, C., Rouge, F., and Galindo, J.R. (1980). Tumorigenicity of human malignant

melanocytes in nude mice in relation to their differentiation in vitro. J Natl Cancer Inst

1029-1040.

Auyez, A., Sayan, A.E., Kriajevska, M., and Tulchinsky, E. (2021). AXL Receptor in Cancer

Metastasis and Drug Resistance: When Normal Functions Go Askew. Cancers (Basel)

10.3390/cancers13194864.

Bai, J., and Pagano, R.E. (1997). Measurement of spontaneous transfer and transbilayer

movement of BODIPY-labeled lipids in lipid vesicles. Biochemistry

, 8840-8848.

10.1021/bi970145r.

Balaban, S., Shearer, R.F., Lee, L.S., van Geldermalsen, M., Schreuder, M., Shtein, H.C.,

Cairns, R., Thomas, K.C., Fazakerley, D.J., Grewal, T., et al. (2017). Adipocyte lipolysis

links obesity to breast cancer growth: adipocyte-derived fatty acids drive breast cancer cell

proliferation and migration. Cancer & Metabolism

, 1. 10.1186/s40170-016-0163-7.

Bansal, N., Mishra, P.J., Stein, M., DiPaola, R.S., and Bertino, J.R. (2015). Axl receptor

tyrosine kinase is up-regulated in metformin resistant prostate cancer cells. Oncotarget

15321-15331. 10.18632/oncotarget.4148.

Boshuizen, J., Koopman, L.A., Krijgsman, O., Shahrabi, A., van den Heuvel, E.G., Ligtenberg,

M.A., Vredevoogd, D.W., Kemper, K., Kuilman, T., Song, J.Y., et al. (2018). Cooperative

targeting of melanoma heterogeneity with an AXL antibody-drug conjugate and

BRAF/MEK inhibitors. Nat Med

, 203-212. 10.1038/nm.4472.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Cao, X., Tay, A., Guy, G.R., and Tan, Y.H. (1996). Activation and association of Stat3 with

Src in v-Src-transformed cell lines. Mol Cell Biol

, 1595-1603. 10.1128/MCB.16.4.1595.

Carreira, S., Goodall, J., Denat, L., Rodriguez, M., Nuciforo, P., Hoek, K.S., Testori, A., Larue,

L., and Goding, C.R. (2006). Mitf regulation of Dia1 controls melanoma proliferation and

invasiveness. Genes Dev

, 3426-3439. 10.1101/gad.406406.

Catalan, V., Gomez-Ambrosi, J., Rodriguez, A., Perez-Hernandez, A.I., Gurbindo, J., Ramirez,

B., Mendez-Gimenez, L., Rotellar, F., Valenti, V., Moncada, R., et al. (2014). Activation of

noncanonical Wnt signaling through WNT5A in visceral adipose tissue of obese subjects is

related to inflammation. J Clin Endocrinol Metab

, E1407-1417. 10.1210/jc.2014-1191.

Cerami, E., Gao, J., Dogrusoz, U., Gross, B.E., Sumer, S.O., Aksoy, B.A., Jacobsen, A., Byrne,

C.J., Heuer, M.L., Larsson, E., et al. (2012). The cBio cancer genomics portal: an open

platform for exploring multidimensional cancer genomics data. Cancer Discov.

, 401-404.

10.1158/2159-8290.CD-12-0095.

Chauhan, J.S., Holzel, M., Lambert, J.P., Buffa, F.M., and Goding, C.R. (2022). The MITF

regulatory network in melanoma. Pigment Cell Melanoma Res

, 517-533.

10.1111/pcmr.13053.

Chocarro-Calvo, A., Garcia-Martinez, J.M., Ardila-Gonzalez, S., De la Vieja, A., and Garcia-

Jimenez, C. (2013). Glucose-induced beta-catenin acetylation enhances Wnt signaling in

cancer. Mol Cell

, 474-486. 10.1016/j.molcel.2012.11.022.

Chretien, A., Piront, N., Delaive, E., Demazy, C., Ninane, N., and Toussaint, O. (2008).

Increased abundance of cytoplasmic and nuclear caveolin 1 in human diploid fibroblasts in

H(2)O(2)-induced premature senescence and interplay with p38alpha(MAPK). FEBS Lett

582

, 1685-1692. 10.1016/j.febslet.2008.04.026.

Clevers, H. (2006). Wnt/beta-catenin signaling in development and disease. Cell

127

, 469-480.

Colavito, S.A. (2020). AXL as a Target in Breast Cancer Therapy. J Oncol

2020

, 5291952.

10.1155/2020/5291952.

Conde-Perez, A., Gros, G., Longvert, C., Pedersen, M., Petit, V., Aktary, Z., Viros, A., Gesbert,

F., Delmas, V., Rambow, F., et al. (2015). A caveolin-dependent and PI3K/AKT-

independent role of PTEN in

-catenin transcriptional activity. Nat Commun

, 8093.

10.1038/ncomms9093.

Creedon, H., Byron, A., Main, J., Hayward, L., Klinowska, T., and Brunton, V.G. (2014).

Exploring mechanisms of acquired resistance to HER2 (human epidermal growth factor

receptor 2)-targeted therapies in breast cancer. Biochem Soc Trans

, 822-830.

10.1042/BST20140109.

Damsky, W.E., Curley, D.P., Santhanakrishnan, M., Rosenbaum, L.E., Platt, J.T., Gould

Rothberg, B.E., Taketo, M.M., Dankort, D., Rimm, D.L., McMahon, M., and Bosenberg,

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

M. (2011). beta-Catenin Signaling Controls Metastasis in Braf-Activated Pten-Deficient

Melanomas. Cancer Cell

, 741-754. S1535-6108(11)00405-3 [pii]

10.1016/j.ccr.2011.10.030.

De Palma, M., Biziato, D., and Petrova, T.V. (2017). Microenvironmental regulation of tumour

angiogenesis. Nat Rev Cancer

, 457-474. 10.1038/nrc.2017.51.

Debruyne, D.N., Bhatnagar, N., Sharma, B., Luther, W., Moore, N.F., Cheung, N.K., Gray,

N.S., and George, R.E. (2016). ALK inhibitor resistance in ALK(F1174L)-driven

neuroblastoma is associated with AXL activation and induction of EMT. Oncogene

3681-3691. 10.1038/onc.2015.434.

Delmas, V., Beermann, F., Martinozzi, S., Carreira, S., Ackermann, J., Kumasaka, M., Denat,

L., Goodall, J., Luciani, F., Viros, A., et al. (2007). Beta-catenin induces immortalization of

melanocytes by suppressing p16INK4a expression and cooperates with N-Ras in melanoma

development. Genes Dev

, 2923-2935. 21/22/2923 [pii]

10.1101/gad.450107.

Dirat, B., Bochet, L., Dabek, M., Daviaud, D., Dauvillier, S., Majed, B., Wang, Y.Y., Meulle,

A., Salles, B., Le Gonidec, S., et al. (2011). Cancer-associated adipocytes exhibit an

activated phenotype and contribute to breast cancer invasion. Cancer Res

, 2455-2465.

10.1158/0008-5472.CAN-10-3323.

Doege, H., and Stahl, A. (2006). Protein-mediated fatty acid uptake: novel insights from in vivo

models. Physiology (Bethesda)

, 259-268. 10.1152/physiol.00014.2006.

Elkabets, M., Pazarentzos, E., Juric, D., Sheng, Q., Pelossof, R.A., Brook, S., Benzaken, A.O.,

Rodon, J., Morse, N., Yan, J.J., et al. (2015). AXL mediates resistance to PI3K

inhibition

by activating the EGFR/PKC/mTOR axis in head and neck and esophageal squamous cell

carcinomas. Cancer Cell

, 533-546. 10.1016/j.ccell.2015.03.010.

Falletta, P., Sanchez-del-Campo, L., Chauhan, J., Effern, M., Kenyon, A., Kershaw, C.J.,

Siddaway, R., Lisle, R., Freter, R., Daniels, M., et al. (2017). Translation reprogramming is

an evolutionarily conserved driver of phenotypic plasticity and therapeutic resistance in

melanoma. Genes Dev

, 18-33.

Fogh, J., Fogh, J.M., and Orfeo, T. (1977). One hundred and twenty-seven cultured human

tumor cell lines producing tumors in nude mice. J Natl Cancer Inst

, 221-226.

Gao, C., Chen, G., Kuan, S.F., Zhang, D.H., Schlaepfer, D.D., and Hu, J. (2015). FAK/PYK2

promotes the Wnt/beta-catenin pathway and intestinal tumorigenesis by phosphorylating

GSK3beta. eLife

. 10.7554/eLife.10072.

Gao, J., Aksoy, B.A., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S.O., Sun, Y., Jacobsen,

A., Sinha, R., Larsson, E., et al. (2013). Integrative analysis of complex cancer genomics

and clinical profiles using the cBioPortal. Science Signaling

, pl1.

10.1126/scisignal.2004088.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

García-Jiménez, C., and Goding, C.R. (2019). Starvation and Pseudo-Starvation as Drivers of

Cancer Metastasis through Translation Reprogramming. Cell Metab

, 258-267.

García-Jiménez, C., Gutierrez-Salmeron, M., Chocarro-Calvo, A., Garcia-Martinez, J.M.,

Castano, A., and De la Vieja, A. (2016). From obesity to diabetes and cancer:

epidemiological links and role of therapies. Brit J Cancer

114

, 716-722.

10.1038/bjc.2016.37.

Gay, C.M., Balaji, K., and Byers, L.A. (2017). Giving AXL the axe: targeting AXL in human

malignancy. Brit J Cancer

116

, 415-423. 10.1038/bjc.2016.428.

Gerstberger, S., Jiang, Q., and Ganesh, K. (2023). Metastasis. Cell

186

, 1564-1579.

10.1016/j.cell.2023.03.003.

Giard, D.J., Aaronson, S.A., Todaro, G.J., Arnstein, P., Kersey, J.H., Dosik, H., and Parks,

W.P. (1973). In vitro cultivation of human tumors: establishment of cell lines derived from

a series of solid tumors. J Natl Cancer Inst

, 1417-1423.

Goding, C.R., and Arnheiter, H. (2019). MITF - The first 25 years. Genes Dev

, 983-1007.

doi: 10.1101/gad.324657.119.

Goodall, J., Carreira, S., Denat, L., Kobi, D., Davidson, I., Nuciforo, P., Sturm, R.A., Larue,

L., and Goding, C.R. (2008). Brn-2 represses microphthalmia-associated transcription factor

expression and marks a distinct subpopulation of microphthalmia-associated transcription

factor-negative melanoma cells. Cancer Res

, 7788-7794. 10.1158/0008-5472.CAN-08-

1053.

Hanahan, D. (2022). Hallmarks of Cancer: New Dimensions. Cancer Discov

, 31-46.

10.1158/2159-8290.CD-21-1059.

Hau, A.M., Gupta, S., Leivo, M.Z., Nakashima, K., Macias, J., Zhou, W., Hodge, A.,

Wulfkuhle, J., Conkright, B., Bhuvaneshwar, K., et al. (2019). Dynamic Regulation of

Caveolin-1 Phosphorylation and Caveolae Formation by Mammalian Target of Rapamycin

Complex 2 in Bladder Cancer Cells. Am J Path

189

, 1846-1862.

10.1016/j.ajpath.2019.05.010.

Henderson, G.C. (2021). Plasma Free Fatty Acid Concentration as a Modifiable Risk Factor

for Metabolic Disease. Nutrients

. 10.3390/nu13082590.

Herlyn, M., Thurin, J., Balaban, G., Bennicelli, J.L., Herlyn, D., Elder, D.E., Bondi, E., Guerry,

D., Nowell, P., Clark, W.H., and et al. (1985). Characteristics of cultured human

melanocytes isolated from different stages of tumor progression. Cancer Res

, 5670-5676.

Hirata, E., Girotti, M.R., Viros, A., Hooper, S., Spencer-Dene, B., Matsuda, M., Larkin, J.,

Marais, R., and Sahai, E. (2015). Intravital Imaging Reveals How BRAF Inhibition

Generates Drug-Tolerant Microenvironments with High Integrin beta1/FAK Signaling.

Cancer Cell

, 574-588. 10.1016/j.ccell.2015.03.008.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Hodson, L., Skeaff, C.M., and Fielding, B.A. (2008). Fatty acid composition of adipose tissue

and blood in humans and its use as a biomarker of dietary intake. Prog Lipid Res

, 348-

380. 10.1016/j.plipres.2008.03.003.

Hoek, K., and Goding, C.R. (2010). Cancer stem cells versus phenotype switching in

melanoma. Pigment Cell Melanoma Res.

, 746-759.

Hollander, D.M., Devereux, D.F., Taylor, C.G., and Taylor, D.D. (1986). Demonstration of

lipolytic activity from cultured human melanoma cells. J Surg Res

, 445-449.

Hoy, A.J., Nagarajan, S.R., and Butler, L.M. (2021). Tumour fatty acid metabolism in the

context of therapy resistance and obesity. Nat Rev Cancer

, 753-766. 10.1038/s41568-

021-00388-4.

Hugo, W., Zaretsky, J.M., Sun, L., Song, C., Moreno, B.H., Hu-Lieskovan, S., Berent-Maoz,

B., Pang, J., Chmielowski, B., Cherry, G., et al. (2016). Genomic and Transcriptomic

Features of Response to Anti-PD-1 Therapy in Metastatic Melanoma. Cell

165

, 35-44.

10.1016/j.cell.2016.02.065.

Insull, W., Jr., and Bartsch, G.E. (1967). Fatty acid composition of human adipose tissue related

to age, sex, and race. Am J Clin Nutr

, 13-23. 10.1093/ajcn/20.1.13.

Kalkavan, H., Chen, M.J., Crawford, J.C., Quarato, G., Fitzgerald, P., Tait, S.W.G., Goding,

C.R., and Green, D.R. (2022). Sublethal cytochrome c release generates drug-tolerant

persister cells. Cell

185

, 3356-3374 e3322. 10.1016/j.cell.2022.07.025.

Kmiecik, T.E., Johnson, P.J., and Shalloway, D. (1988). Regulation by the autophosphorylation

site in overexpressed pp60c-src. Mol Cell Biol

, 4541-4546. 10.1128/mcb.8.10.4541.

Kokatnur, M.G., Oalmann, M.C., Johnson, W.D., Malcom, G.T., and Strong, J.P. (1979). Fatty

acid composition of human adipose tissue from two anatomical sites in a biracial

community. Am J Clin Nutr

, 2198-2205. 10.1093/ajcn/32.11.2198.

Konieczkowski, D.J., Johannessen, C.M., Abudayyeh, O., Kim, J.W., Cooper, Z.A., Piris, A.,

Frederick, D.T., Barzily-Rokni, M., Straussman, R., Haq, R., et al. (2014). A melanoma cell

state distinction influences sensitivity to MAPK pathway inhibitors. Cancer Discov

, 816-

827. 10.1158/2159-8290.CD-13-0424.

Kwan, H.Y., Fu, X., Liu, B., Chao, X., Chan, C.L., Cao, H., Su, T., Tse, A.K., Fong, W.F., and

Yu, Z.-L.L. (2014). Subcutaneous adipocytes promote melanoma cell growth by activating

the Akt signaling pathway: role of palmitic acid. J Biol Chem

289

, 30525-30537.

10.1074/jbc.M114.593210.

Lazar, I., Clement, E., Dauvillier, S., Milhas, D., Ducoux-Petit, M., LeGonidec, S., Moro, C.,

Soldan, V., Dalle, S., Balor, S., et al. (2016). Adipocyte Exosomes Promote Melanoma

Aggressiveness through Fatty Acid Oxidation: A Novel Mechanism Linking Obesity and

Cancer. Cancer Res

, 4051-4057. 10.1158/0008-5472.CAN-16-0651.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Lee, H.J., Chen, Z., Collard, M., Chen, F., J.G., C., Wu, M., Alani, R.M., and Chen, J.-X.

(2021). Multimodal metabolic imaging reveals pigment reduction and lipid accumulation in

metastatic melanoma. BMEF

2021

, 986Q123.

Li, S., Seitz, R., and Lisanti, M.P. (1996). Phosphorylation of caveolin by src tyrosine kinases.

The alpha-isoform of caveolin is selectively phosphorylated by v-Src in vivo. J Biol Chem

271

, 3863-3868.

Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-

time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods

, 402-408.

10.1006/meth.2001.1262.

Louphrasitthiphol, P., Chauhan, J., and Goding, C.R. (2020). ABCB5 is activated by MITF and

beta-catenin and is associated with melanoma differentiation. Pigment Cell Melanoma Res

, 112-118. 10.1111/pcmr.12830.

Louphrasitthiphol, P., Ledaki, I., Chauhan, J., Falletta, P., Siddaway, R., Buffa, F.M., Mole,

D.R., Soga, T., and Goding, C.R. (2019). MITF controls the TCA cycle to modulate the

melanoma hypoxia response. Pigment Cell Melanoma Res

, 792-808.

10.1111/pcmr.12802.

Lumaquin-Yin, D., Montal, E., Johns, E., Baggiolini, A., Huang, T.H., Ma, Y., LaPlante, C.,

Suresh, S., Studer, L., and White, R.M. (2023). Lipid droplets are a metabolic vulnerability

in melanoma. Nat Commun

, 3192. 10.1038/s41467-023-38831-9.

Lyssiotis, C.A., and Kimmelman, A.C. (2017). Metabolic Interactions in the Tumor

Microenvironment. Trends Cell Biol

, 863-875. 10.1016/j.tcb.2017.06.003.

Martinez-Outschoorn, U.E., Lisanti, M.P., and Sotgia, F. (2014). Catabolic cancer-associated

fibroblasts transfer energy and biomass to anabolic cancer cells, fueling tumor growth.

Seminars in Cancer Biol

, 47-60. 10.1016/j.semcancer.2014.01.005.

Mattern, H.M., Raikar, L.S., and Hardin, C.D. (2009). The effect of caveolin-1 (Cav-1) on fatty

acid uptake and CD36 localization and lipotoxicity in vascular smooth muscle (VSM) cells.

Int J Physiol Pathophysiol Pharmacol

, 1-14.

Morfoisse, F., De Toni, F., Nigri, J., Hosseini, M., Zamora, A., Tatin, F., Pujol, F., Sarry, J.E.,

Langin, D., Lacazette, E., et al. (2021). Coordinating Effect of VEGFC and Oleic Acid

Participates to Tumor Lymphangiogenesis. Cancers (Basel)

. 10.3390/cancers13122851.

Muller, C., Nieto, L., and Valet, P. (2013). Unraveling the Local Influence of Tumor-

Surrounding Adipose Tissue on Tumor Progression: Cellular and Molecular Actors

Involved. In Adipose Tissue and Cancer, M.G. KOLONIN, ed.

Muller, J., Krijgsman, O., Tsoi, J., Robert, L., Hugo, W., Song, C., Kong, X., Possik, P.A.,

Cornelissen-Steijger, P.D., Foppen, M.H., et al. (2014). Low MITF/AXL ratio predicts early

resistance to multiple targeted drugs in melanoma. Nat Commun

, 5712.

10.1038/ncomms6712.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Nakajima, E.C., and Van Houten, B. (2013). Metabolic symbiosis in cancer: refocusing the

Warburg lens. Mol Carcinogenesis

, 329-337. 10.1002/mc.21863.

Nieman, K.M., Kenny, H.A., Penicka, C.V., Ladanyi, A., Buell-Gutbrod, R., Zillhardt, M.R.,

Romero, I.L., Carey, M.S., Mills, G.B., Hotamisligil, G.S., et al. (2011). Adipocytes

promote ovarian cancer metastasis and provide energy for rapid tumor growth. Nat Med

1498-1503. nm.2492 [pii]

10.1038/nm.2492.

Ortiz, R., Diaz, J., Diaz, N., Lobos-Gonzalez, L., Cardenas, A., Contreras, P., Diaz, M.I., Otte,

E., Cooper-White, J., Torres, V., et al. (2016). Extracellular matrix-specific Caveolin-1

phosphorylation on tyrosine 14 is linked to augmented melanoma metastasis but not

tumorigenesis. Oncotarget

, 40571-40593. 10.18632/oncotarget.9738.

Pandey, V., Vijayakumar, M.V., Ajay, A.K., Malvi, P., and Bhat, M.K. (2012). Diet-induced

obesity increases melanoma progression: involvement of Cav-1 and FASN. Int. J Cancer

130

, 497-508. 10.1002/ijc.26048.

Pascual, G., Avgustinova, A., Mejetta, S., Martín, M., Castellanos, A., Attolini, C.S.-O.,

Berenguer, A., Prats, N., Toll, A., Hueto, J.A., et al. (2016). Targeting metastasis-initiating

cells through the fatty acid receptor CD36. Nature

541

, 41-45. doi:10.1038/nature20791.

Pavlova, N.N., and Thompson, C.B. (2016). The Emerging Hallmarks of Cancer Metabolism.

Cell Metab

, 27-47. 10.1016/j.cmet.2015.12.006.

Pohl, J., Ring, A., Ehehalt, R., Herrmann, T., and Stremmel, W. (2004). New concepts of

cellular fatty acid uptake: role of fatty acid transport proteins and of caveolae. Proc Nutr Soc

, 259-262. 10.1079/PNS2004341.

Pohl, J., Ring, A., Korkmaz, U., Ehehalt, R., and Stremmel, W. (2005). FAT/CD36-mediated

long-chain fatty acid uptake in adipocytes requires plasma membrane rafts. Mol Biol Cell

, 24-31. 10.1091/mbc.e04-07-0616.

Rabbani, P., Takeo, M., Chou, W., Myung, P., Bosenberg, M., Chin, L., Taketo, M.M., and Ito,

M. (2011). Coordinated activation of Wnt in epithelial and melanocyte stem cells initiates

pigmented hair regeneration. Cell

145

, 941-955. S0092-8674(11)00530-7 [pii]

10.1016/j.cell.2011.05.004.

Rambow, F., Marine, J.C., and Goding, C.R. (2019). Melanoma plasticity and phenotypic

diversity: therapeutic barriers and opportunities Genes Dev

, 1295-1318.

Rambow, F., Rogiers, A., Marin-Bejar, O., Aibar, S., Femel, J., Dewaela, M., Karras, P.,

Brown, D., Chang, Y.H., Debiec-Rychter, M., et al. (2018). Towards minimal residual

disease-directed therapy in melanoma. Cell

174

, 843-855.

Riesenberg, S., Groetchen, A., Siddaway, R., Bald, T., Reinhardt, J., Smorra, D., Kohlmeyer,

J., Renn, M., Phung, B., Aymans, P., et al. (2015). MITF and c-Jun antagonism interconnects

melanoma dedifferentiation with pro-inflammatory cytokine responsiveness and myeloid

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

cell

recruitment.

Nat

Commun

8755

DOI:8710.1038

ncomss9755.

10.1038/ncomms9755.

Ring, A., Le Lay, S., Pohl, J., Verkade, P., and Stremmel, W. (2006). Caveolin-1 is required

for fatty acid translocase (FAT/CD36) localization and function at the plasma membrane of

mouse embryonic fibroblasts. Biochimica Biophysica Acta

1761

, 416-423.

10.1016/j.bbalip.2006.03.016.

Sandoval, A., Chokshi, A., Jesch, E.D., Black, P.N., and Dirusso, C.C. (2010). Identification

and characterization of small compound inhibitors of human FATP2. Biochem Pharmacol

, 990-999. 10.1016/j.bcp.2009.11.008.

Sanna, E., Miotti, S., Mazzi, M., De Santis, G., Canevari, S., and Tomassetti, A. (2007).

Binding of nuclear caveolin-1 to promoter elements of growth-associated genes in ovarian

carcinoma cells. Exp Cell Res

313

, 1307-1317. 10.1016/j.yexcr.2007.02.005.

Shao, H., Teramae, D., and Wells, A. (2023). Axl contributes to efficient migration and

invasion of melanoma cells. PloS one

, e0283749. 10.1371/journal.pone.0283749.

Sharma, S.V., Lee, D.Y., Li, B., Quinlan, M.P., Takahashi, F., Maheswaran, S., McDermott,

U., Azizian, N., Zou, L., Fischbach, M.A., et al. (2010). A chromatin-mediated reversible

drug-tolerant state in cancer cell subpopulations. Cell

141

, 69-80. S0092-8674(10)00180-7

[pii]

10.1016/j.cell.2010.02.027.

Smolle, J., Woltsche, I., Hofmann-Wellenhof, R., Haas, J., and Kerl, H. (1995). Pathology of

tumor-stroma interaction in melanoma metastatic to the skin. Hum Pathol

, 856-861.

Sommer, L. (2011). Generation of Melanocytes from Neural Crest Cells. Pigment Cell

Melanoma Res. 10.1111/j.1755-148X.2011.00834.x.

Sonveaux, P., Vegran, F., Schroeder, T., Wergin, M.C., Verrax, J., Rabbani, Z.N., De

Saedeleer, C.J., Kennedy, K.M., Diepart, C., Jordan, B.F., et al. (2008). Targeting lactate-

fueled respiration selectively kills hypoxic tumor cells in mice. J Clin Invest

118

, 3930-

3942. 10.1172/JCI36843.

Sousa, C.M., Biancur, D.E., Wang, X., Halbrook, C.J., Sherman, M.H., Zhang, L., Kremer, D.,

Hwang, R.F., Witkiewicz, A.K., Ying, H., et al. (2016). Pancreatic stellate cells support

tumour metabolism through autophagic alanine secretion. Nature

536

, 479-483.

10.1038/nature19084.

Tagawa, A., Mezzacasa, A., Hayer, A., Longatti, A., Pelkmans, L., and Helenius, A. (2005).

Assembly and trafficking of caveolar domains in the cell: caveolae as stable, cargo-

triggered, vesicular transporters. J Cell Biol

170

, 769-779. 10.1083/jcb.200506103.

Tsoi, J., Robert, L., Paraiso, K., Galvan, C., Sheu, K.M., Lay, J., Wong, D.J.L., Atefi, M.,

Shirazi, R., Wang, X., et al. (2018). Multi-stage Differentiation Defines Melanoma Subtypes

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

with Differential Vulnerability to Drug-Induced Iron-Dependent Oxidative Stress. Cancer

Cell

, 890-904 e895. 10.1016/j.ccell.2018.03.017.

Ubellacker, J.M., Tasdogan, A., Ramesh, V., Shen, B., Mitchell, E.C., Martin-Sandoval, M.S.,

Gu, Z., McCormick, M.L., Durham, A.B., Spitz, D.R., et al. (2020). Lymph protects

metastasizing melanoma cells from ferroptosis. Nature

585

, 113-118. 10.1038/s41586-020-

2623-z.

Veeman, M.T., Slusarski, D.C., Kaykas, A., Louie, S.H., and Moon, R.T. (2003). Zebrafish

prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements.

Curr Biol

, 680-685. 10.1016/s0960-9822(03)00240-9.

Vivas-Garcia, Y., Falletta, P., Liebing, J., Louphrasitthiphol, P., Feng, Y., Chauhan, J., Scott,

D.A., Glodde, N., Chocarro-Calvo, A., Bonham, S., et al. (2020). Lineage-Restricted

Regulation of SCD and Fatty Acid Saturation by MITF Controls Melanoma Phenotypic

Plasticity. Mol Cell

, 120-139. 10.1016/j.molcel.2019.10.014.

Wagner, M., Bjerkvig, R., Wiig, H., Melero-Martin, J.M., Lin, R.Z., Klagsbrun, M., and

Dudley, A.C. (2012). Inflamed tumor-associated adipose tissue is a depot for macrophages

that stimulate tumor growth and angiogenesis. Angiogenesis

, 481-495. 10.1007/s10456-

012-9276-y.

Wang, C., Jin, H., Wang, N., Fan, S., Wang, Y., Zhang, Y., Wei, L., Tao, X., Gu, D., Zhao, F.,

et al. (2016). Gas6/Axl Axis Contributes to Chemoresistance and Metastasis in Breast

Cancer through Akt/GSK-3beta/beta-catenin Signaling. Theranostics

, 1205-1219.

10.7150/thno.15083.

Weeraratna, A.T., Jiang, Y., Hostetter, G., Rosenblatt, K., Duray, P., Bittner, M., and Trent,

J.M. (2002). Wnt5a signaling directly affects cell motility and invasion of metastatic

melanoma. Cancer Cell

, 279-288. 10.1016/s1535-6108(02)00045-4.

Widlund, H.R., Horstmann, M.A., Price, E.R., Cui, J., Lessnick, S.L., Wu, M., He, X., and

Fisher, D.E. (2002). Beta-catenin-induced melanoma growth requires the downstream target

Microphthalmia-associated transcription factor. J Cell Biol

158

, 1079-1087.

10.1083/jcb.200202049.

Yang, W., Xia, Y., Ji, H., Zheng, Y., Liang, J., Huang, W., Gao, X., Aldape, K., and Lu, Z.

(2011). Nuclear PKM2 regulates beta-catenin transactivation upon EGFR activation. Nature

480

, 118-122. 10.1038/nature10598.

Zakut, R., Perlis, R., Eliyahu, S., Yarden, Y., Givol, D., Lyman, S.D., and Halaban, R. (1993).

KIT ligand (mast cell growth factor) inhibits the growth of KIT- expressing melanoma cells.

Oncogene

, 2221-2229.

Zhang, M., Di Martino, J.S., Bowman, R.L., Campbell, N.R., Baksh, S.C., Simon-Vermot, T.,

Kim, I.S., Haldeman, P., Mondal, C., Yong-Gonzales, V., et al. (2018). Adipocyte-Derived

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Lipids Mediate Melanoma Progression via FATP Proteins. Cancer Discov

, 1006-1025.

10.1158/2159-8290.CD-17-1371.

Zhang, Z., Lee, J.C., Lin, L., Olivas, V., Au, V., LaFramboise, T., Abdel-Rahman, M., Wang,

X., Levine, A.D., Rho, J.K., et al. (2012). Activation of the AXL kinase causes resistance

to EGFR-targeted therapy in lung cancer. Nat Genet

, 852-860. 10.1038/ng.2330.

Zhou, L., Liu, X.D., Sun, M., Zhang, X., German, P., Bai, S., Ding, Z., Tannir, N., Wood, C.G.,

Matin, S.F., et al. (2016). Targeting MET and AXL overcomes resistance to sunitinib

therapy in renal cell carcinoma. Oncogene

, 2687-2697. 10.1038/onc.2015.343.

Zoico, E., Darra, E., Rizzatti, V., Budui, S., Franceschetti, G., Mazzali, G., Rossi, A.P., Fantin,

F., Menegazzi, M., Cinti, S., and Zamboni, M. (2016). Adipocytes WNT5a mediated

dedifferentiation: a possible target in pancreatic cancer microenvironment. Oncotarget

20223-20235. 10.18632/oncotarget.7936.

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Figure 1. Only MITF

Low

cells induce lipolysis in human adipose explants. A.

Schematic showing

experimental system for adipose tissue explant-melanoma cell co-culture in which the explant and

melanoma cells are separated by a lipid permeable membrane.

Nile red staining of melanoma cells

in mono-culture or co-culture with human adipose tissue explants for 4 days. DAPI is used to stain

nuclei. Scale bar = 50

C, D.

Western blots using indicated antibodies of human adipose tissue

explants co-cultured with indicated melanoma cells and exposed to indicated conditioned medium for 4

days.

Heatmap showing relative mRNA expression of indicated genes in CCLE melanoma cell lines

ranked by

MITF

expression.

. Plot showing

WNT5a

mRNA expression (grey bars) in the TCGA

melanoma cohort ranked by

MITF

expression (black line). The moving average per 20 melanomas of

WNT5a

is shown as the maroon line.

. Western blot of a human adipose tissue explants co-cultured or

not with indicated cell lines +/- 50 ng WNT5a. All samples were run on the same gel.

Figure 2. FATP-independent uptake of oleic acid by MITF

Low

melanoma cells

Indicated

MITF

High

and MITF

Low

cell lines exposed for 16 h or not to 100

M oleic acid in the presence or absence

of 1.25

M Lipofermata and stained using Oil red O. Scale bars indicate 50

m. Insets show typical

cells at higher magnification.

. Quantification of Oil red O staining from cells in (A) n

≥

3, error bars

indicate SEM * P<0.05. Paired t test.

C, D

. Heatmaps showing relative expression of MITF, CD36, and

SLC27A family genes encoding FATPs in an in house panel of 12 melanoma cell lines measured by

triplicate RNA-seq (C), or in the panel of 53 melanoma cell lines clustered by phenotype described in

Tsoi et al. (2018) (D).

. Heatmap showing relative expression of

CAV1

in the Tsoi et al cell lines using

MITF

SOX10

SOX9

and

AXL

expression as markers of indicated phenotypes.

. Heatmap showing

expression of

MITF

AXL

and

CAV1

mRNA in indicated panel of 12 melanoma cell lines by RNA-seq

in triplicate.

. Western blot showing expression of indicated proteins in panel of 12 melanoma cell

lines.

CCLE pan cancer cell lines ranked by

AXL

expression with the moving average of

CAV1

expression indicated in magenta. Grey bars indicate

CAV1

expression in each cell line.

. Nile red

staining of indicated melanoma cell lines exposed to oleic acid for 16 h, pre-treated or not with 25

Nystatin Insets indicate typical cells at higher magnification. Scale bar indicates 50

Quantification of Nile red staining in (I) n

≥

3, error bars indicate SEM * P<0.05. Paired t test.

Figure 3

Oleic acid induces

-catenin-CAV1 interaction and nuclear localization

Immunofluorescence of IGR39 cells using antibodies against indicated proteins in cells exposed to 100

M oleic (OA). Scale bars indicate 50

m for top panels and 20

m for bottom 3 panels.

. Western

blots for indicated proteins from fractionated IGR39 cells treated or not with 100

M OA for over time.

GAPDH and TBP were used as markers of the cytoplasmic and nuclear fractions

. C

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Immunofluorescence of IGR39 cells for indicated proteins after exposure or not to 100

M OA for 6 h.

Scale bars indicate

Western blot of fractionated IGR39 cells treated with oleic acid for

indicated times.

Luciferase reporter assays in indicated cell lines showing the ratio of luciferase

activity from the TOP:FOP-flash

-catenin activity reporters. n= 3, error bars indicate SEM **

<0.01,

***

<0.001. One-Way ANOVA Statistical test.

. Western blot for indicated proteins

immunoprecipitated from IGR39 nuclear extract using anti

-b

-catenin antibody from cells treated or not

with OA 100

M for indicated times. Blot shows both immunoprecipitated (IP) and flow through (FT).

. Western blots for indicated proteins from fractionated IGR39 cells (nuclear upper panels;

cytoplasmic, lower panels) treated or not with 100

M OA for indicated times and transfected with

either control or CAV1-specific siRNA.

Figure 4. OA activates SRC in MITF

Low

cells. A-E

. Western blots for indicated proteins treated with

100

M (OA).

IGR39 cells were treated 12 h with 10

M PP2 +/- 10

M (OA) for another 4 h before

being analysed by western blot.

Immunofluorescence for indicated proteins in IGR39 cells pre-treated

for 12 h with 10

M PP2 and then +/- 10

M (OA) for a further 4 h.

. Western blots of fractionated

extract treated 12h with 10

M PP2 +/- 10

M (OA) for another 4 h.

. Western blots for indicated

proteins of nuclear or chromatin fractions from IGR39 cells treated with 100

M oleic acid (OA) and

transfected where indicated with expression vectors for WT or Y14F mutant CAV1. Arrowheads

indicate ectopic CAV1 WT or Y14F mutant.

. Western blot for indicated proteins of nuclear extracts

of IGR39 cells in co-culture with adipose tissue explants.

Figure 5. Oleic acid activates AXL. A-D.

Western blots of indicated cell lines treated with 100

oleic acid for 4 h unless indicated, and/or pre-treated with AXL inhibitors ONO-7475 (0.5

M for

IGR39 or 0.1

M for WM793) or R428 (0.5

M) for 2 h prior to exposure to OA.

. Schematic

summarising signalling downstream from oleic acid.

. Oil Red O staining of IGR39 and WM793

cells exposed to ONO-7475 (0.5

M) or R428 (0.5

M) for 2h +/- 100

M OA for 12 h more. AXL

inhibitors ONO-7475 (0.5

M ) or R428 (0.5

M ). Insets show enlarged examples of typical cells.

Scale bars indicate 50

m. Quantification (right) of lipid droplet accumulation N=3, Error bars indicate

SEM *

<0.05, **

<0.01***,

<0.001. One-Way ANOVA Statistical test.

Figure 6. Oleic acid induces AXL-dependent invasion in melanoma. A,B,D,E,

Matrigel transwell

invasion assays showing invading cells stained with crystal violet. Where indicated cells were treated

with 100

M oleic acid, and/or transfected with control or siRNAs targeting CAV1 or

-catenin, or co-

cultured with adipose tissue explants, or treated with AXL inhibitors ONO-7475 (0.5

M) or R428 (0.5

M). Assays were performed for 22 h. Quantification from n

≥

3 biological replicates; error bars = SEM;

The copyright holder for this

this version posted January 24, 2024.

bioRxiv preprint

Supplemental Figure 1. Fatty acid uptake by IGR29 and IGR37 cells. A.

Oil red O staining of IGR37

and IGR39 melanoma cells after 4 h exposure to oleic acid (OA). Scale bar = 50

Schematic

showing pre-loading of 3T3-L1 adipocytes with BODIPY (green) before removal of free BODIPY by

washing and co-culture with melanoma cells in a chamber separated by a membrane that permits passage

of small molecules but not cells or cell contact.

BODIPY-FL uptake from pre-loaded 3T3-L1 cells

by IGR37 or IGR39 cells co-cultured for 24 h using mono-cultured melanoma cells as a negative control.

Both melanoma cell lines are positive, indicating their ability to promote release and uptake from the

BODIPY-labelled 3T3-L1 cells.

Supplemental Figure 2. Effect of Oleic acid on

-catenin in IGR37 and IGR39 cells. A, B.

Immunofluorescence showing subcellular localization of

-catenin following treatment with 100

oleic acid or 20 mM LiCl. Anti-Lamin B was used to highlight the nuclear periphery. C. Western blot

of fractionated IGR37 cells following treatment with 100

M oleic acid or 20 mM LiCl.

. Western

blot over time of IGR39 cells treated with 100

M oleic acid or 20 mM LiCl.

qRT PCR showing

expression of

-catenin mRNA relative to GAPDH in IGR39 cells treated with 100

M oleic acid for

24 h.

The copyright holder for this

this version posted January 24, 2024.