PIIS2589004224011003-html.html

Optimization of AAV vectors for transactivator-regulated enhanced gene expression

within targeted neuronal populations.

Leo Kojima

1,8

, Kaoru Seiriki

1,8,9*

, Hiroki Rokujo

, Takanobu Nakazawa

, Atsushi Kasai

Hitoshi Hashimoto

1,4,5,6,7*

Laboratory of Molecular Neuropharmacology, Graduate School of Pharmaceutical

Sciences, Osaka University, Suita, Osaka, 565-0871, Japan

Department of Bioscience, Tokyo University of Agriculture, Setagaya-ku, Tokyo 156-

8502, Japan

Systems Neuropharmacology, Research Institute of Environmental Medicine, Nagoya

University, Nagoya 464-8601, Japan

Institute for Open and Transdisciplinary Research Initiatives, Osaka University, Suita,

Osaka, 565-0871, Japan

Molecular Research Center for Children’s Mental Development, United Graduate

School of Child Development, Osaka University, Kanazawa University, Hamamatsu

University School of Medicine, Chiba University and University of Fukui, Suita, Osaka,

565-0871, Japan

Institute for Datability Science, Osaka University, Suita, Osaka, 565-0871, Japan

Department of Molecular Pharmaceutical Sciences, Graduate School of Medicine, Osaka

University, Suita, Osaka, 565-0871, Japan

These authors contributed equally.

Lead Contact

*Correspondence: seiriki@phs.osaka-u.ac.jp (K.S.), hasimoto@phs.osaka-u.ac.jp (H.H.)

Journal Pre-proof

Summary

Adeno-associated virus (AAV) vectors are potential tools for cell-type-selective gene

delivery to the central nervous system. Although cell-type-specific enhancers and

promoters have been identified for AAV systems, there is limited information regarding

the effects of AAV genomic components on the selectivity and efficiency of gene

expression. Here, we offer an alternative strategy to provide specific and efficient gene

delivery to a targeted neuronal population by optimizing recombinant AAV genomic

components, named TAREGET (TransActivator-Regulated Enhanced Gene Expression

within Targeted neuronal populations). We established this strategy in oxytocinergic

neurons and showed that the TAREGET enabled sufficient gene expression to label long-

projecting axons in wild-type mice. Its application to other cell types, including

serotonergic and dopaminergic neurons, was also demonstrated. These results

demonstrate that optimization of AAV expression cassettes can improve the specificity

and efficiency of cell-type-specific gene expression and that TAREGET can renew

previously established cell-type-specific promoters with improved performance.

Keywords

AAV, cell types, oxytocin, serotonin, dopamine, whole-brain imaging

Motivation

Adeno-associated viral vectors are promising tools for

in vivo

gene delivery. Several

studies have identified promoters and enhancers that enable cell-type-specific gene

expression in the brain. However, it is not well understood whether and to what extent

selectivity and efficiency are reduced, maintained, or improved by the use of gene

expression control systems, such as the Tet-Off and Cre-loxP systems, which enable the

stable and sufficient expression of transgenes. This study reports the basic information

required to construct an AAV vector carrying a cell-type-specific promoter and provides

an AAV system for oxytocin neuron-selective expression of various transgenes.

Journal Pre-proof

Introduction

The brain is composed of heterogeneous neuronal populations, including

glutamatergic, GABAergic, monoaminergic, and neuropeptidergic neurons.

Classification and functional analysis of each cell type are prerequisites for a precise

understanding of brain function and pathologies in brain diseases

1,2

. To achieve this,

transgenic or knock-in animals have been engineered to express exogenous genes such as

fluorescent proteins and Cre recombinase in specific neuronal populations to label or

manipulate the target cell type

3,4

. Despite the high utility of cell-type-selective transgenic

animals, several limitations of these tools have been reported, including the huge effort

required to breed transgenic animals, unintentional off-target and insertional effects

5–10

and insufficient efficiency for labeling

. Backcrossing to the desired genetic background

is also a time-consuming task when the target animal strains differ from the available

genetic backgrounds.

Recently, various adeno-associated virus (AAV) vectors that utilize cell-type-specific

promoters

12–16

or enhancer

17–20

have been developed in order to deliver genes into the

targeted cell types and investigate their anatomical and functional characteristics as

alternative strategies for transgenic animals. However, in some cases, the selectivity and

efficiency of targeted gene expression in the AAV-based approach have been reported to

be relatively lower than those in Cre lines

10,19,21

. Moreover, although some cell-type-

specific promoters for neuromodulator-expressing neurons have been identified, most

have a gene length of 2–3 kilobases (kb)

14,16,21,22

, which occupies approximately half of

the assumed capable genome length of AAV (4.7 kb)

23,24

. These limitations may prevent

the application of the AAV-based cell-type-specific approaches to broader experimental

designs.

Oxytocin (OXT) neurons are involved in a wide range of physiological phenomena

including social and nurturing behaviors

25–28

. Reduced sociability can be associated with

impaired OXT systems in some animal models, as we and others have previously

Journal Pre-proof

identified reduced OXT or its receptor in mouse models of neurodevelopmental disorders

that harbor genetic mutations or deletions of genes associated with human autism

spectrum disorder

29–31

. Thus, viral-genetic targeting of OXT neurons in genetic mouse

models or inbred mouse strains for diseases may help understand the anatomical and

functional properties of OXT neurons in healthy and diseased states. AAV-based cell-

type-specific approaches for oxytocin (OXT) neurons have been well established

32–34

and

reproduced in multiple independent studies

28,35

. These applications mainly employ a

single AAV vector system in which the OXT promoter directly drives the expression of

transgenes. Although dual AAV vector systems carrying Cre/loxP or Tet-Off systems

allow us to use a larger gene size, the selectivity for OXT neurons is reduced compared

to the single AAV vector system

. Alternative AAV strategies with improved versatility

may shed light on the neuronal mechanisms underlying social behavior and impairment

in animal models.

Here, we propose the TransActivator-Regulated enhanced Gene Expression within

Targeted neuronal populations (TAREGET) strategy for AAV-mediated cell-type-specific

gene expression in wild-type mice. Using previously reported OXT promoters

, we

optimized the regulatory components of gene expression, thereby improving both the

specificity and efficiency of gene expression via the Tet-Off system in OXT neurons. AAV

TAREGET-OXT (TAREGET for OXT neurons) restricts the high expression levels of

reporter fluorescent proteins within OXT neurons, and that allows whole-brain

visualization of long-projecting OXT neuronal axons across multiple brain regions in

wild-type mice. Furthermore, the TAREGET strategy is applicable to other cell types,

such as serotonergic and dopaminergic neurons, by using their specific promoters. These

results provide important insights into viral vector strategies targeting specific neuronal

populations.

Journal Pre-proof

Results

Optimization of regulatory components in the AAV vector enables selective and

robust gene expression in OXT neurons

Previous studies suggest that inverted terminal repeat (ITR) sequences in the AAV

genome can act as a promoter

, and its undesired action may be attenuated by insertion

of the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) with

inverted orientation into the 5’ upstream of cell-type-selective promoter

. Although the

insertion of inverted WPRE is known to decrease gene expression at the mRNA level

these effects in AAV vectors have been less investigated quantitatively. To examine

whether the position of regulatory components affects cell-type selectivity and

compatibility to Tet-Off-mediated enhanced gene expression in OXT neurons, we

compared seven patterns of AAV vector sets, all of which have a 1.0 kb fragment of the

mouse OXT (mOXT) promoter

and reporter fluorescent protein, mNeonGreen (mNG)

which is one of the brightest monomeric green fluorescent proteins in neuronal

experiments. All AAV vectors were packaged into the AAV serotype 9 capsid and

administered to the paraventricular nucleus of the hypothalamus (PVH) at a dose of 1 ×

vg via bilateral stereotaxic injection (

Figure 1A

). In the single AAV vector system

(

Figure 1B

, AAV #1–3), insertion of WPRE into 3’ untranslated region (UTR) increased

the number of mNG-positive cells in OXT neurons immunolabeled with antibody for

Neurophysin 1 (NP1), which is a cleavage product from an OXT-precursor protein and a

reliable marker for OXT neurons

41,42

. AAV #2 carrying the 3’ WPRE achieved over 90%

specificity of mNG expression in the OXT neurons (

Figure 1C

); however, only 59.1% of

the NP1-positive cells were labeled with mNG (

Figure 1D

). These results suggest that in

the single AAV system, the transcriptional activity of the 1.0 kb mOXT promoter is

insufficient for labeling a large population of OXT neurons.

The low labeling efficiency can be attributed to the undetectable levels of mNG

expression in the targeted neuronal populations. Given that the Tet system can be used

not only for inducible expression of the target gene but also for the transcriptional

Journal Pre-proof

amplification of cell-type-specific promoters

43,44

, we examined whether using a Tet

system would improve the expression levels of mNG controlled by the 1.0 kb mOXT

promoter. For this purpose, we designed dual AAV vectors, which comprised a pair of

AAVs carrying the tetracycline transactivator (tTA) under the mOXT promoter and mNG

under the tetracycline response element (TRE) promoter, respectively (

Figure 1B

, AAV

sets #4–8). The effects of WPRE in 3’ UTR with forward orientation and that in 5’

upstream of the promoter with inverted orientation were also evaluated in AAV sets #5–

8. The combination of inverted WPRE at 5’ upstream of mOXT promoter and tTA (AAV

set #8) showed the comparable selectivity for OXT neurons with the single AAV system

#2 (93.1% vs. 93.8%;

Figure 1C

). Furthermore, the selectivity and labeling efficiency of

AAV set #8 were higher than those of AAV set #5, which lacks the inverted WPRE at 5’

upstream of the promoter (

Figure 1D

), suggesting that the inverted WPRE can improve

both cell-type specificity and efficiency of gene expression. Insertion of forward WPRE

into the 3’ UTR of AAV sets #6 and 7, which enhances tTA expression, resulted in a

greater overall number of mNG-expressing cells including non-OXT neurons (

Figures

S1A and S1B

). Consequently, the specificity of mNG induction in OXT neurons was

reduced in the AAV sets #6 and 7 compared to the AAV set #8 (

Figure 1C

). Despite the

broader mNG expression, labeling efficiency in OXT neurons also decreased (

Figure 1D

Given that extremely high-level expression of fluorescent proteins can be toxic

, we

evaluated the number of NP1-positive cells and cell death induction for AAV sets #6 and

7. These groups exhibited a reduction in the number of NP1-positive cells (

Figures S1A–

) and an increase in the number of active caspase-3-positive cells (

Figures S2A–C

suggesting that the reduction of mNG- and NP1-double-positive cells for AAV sets #6

and 7 was due to cytotoxicity. These results indicate that the dual AAV system, in which

a tTA driver AAV carrying 5’ inverted WPRE and a TRE reporter AAV carrying gene of

interests with WPRE in the 3’ UTR, can improve the selectivity and labeling efficiency

of weak promoters for cell-type-specific gene expression. Therefore, we named this dual

Journal Pre-proof

AAV system AAV TransActivator-Regulated Gene Expression within Targeted neuronal

Populations (TAREGET)-OXT.

AAV TAREGET yields cell-type-selective gene expression but requires optimal

promoter activity for cell-type selectivity

To evaluate the robustness and scalability of the TAREGET strategy, we examined

whether a different type of mOXT promoter in the AAV TAREGET system retains cell-

type selectivity. Recent studies have shown that AAV carrying the 2–2.6 kb mOXT

promoter drives selective gene expression in OXT neurons

28,32,34

, and a variety of genes

have been successfully transduced to OXT neurons selectively, including not only

fluorescent proteins but also designer receptors exclusively activated by designer drugs

(DREADD), hM3Dq

, and a genetically encoded calcium indicator, GCaMP

36,46

Therefore, the longer mOXT promoter was considered to have more effective

transcriptional activity than the 1.0 kb mOXT promoter. However, the use of strong

promoters carries the risk of increased background expression when combined with the

Tet-Off amplification system. We thus compared the previously used 1.0 kb OXT

promoter with the stronger 2.6 kb promoter to determine whether the TAREGET strategy

was applicable to stronger promoters for cell-type-specific labeling (

Figure 2A

Although the dual AAV system carrying the 2.6 kb mOXT promoter yielded brighter

fluorescent signals and labeled the majority of NP1-positive neurons in the PVH (

Figures

2B and S3A

), cell-type selectivity was decreased to approximately 30% (

Figure 2C

Non-selective mNG expression in arginine vasopressin (AVP)-expressing neurons was

also observed in 19.0% of mNG-positive neurons using the 2.6 kb mOXT promoter

system, whereas less than 1.0% of mNG-positive neurons were AVP-positive in the 1.0

kb mOXT promoter system (

Figures 2D, 2E, and S3B

). The selectivity of the 1.0 kb

mOXT promoter-based TAREGET was maintained throughout the anteroposterior axis

(

Figures S4A–C

). These results suggest that the TAREGET strategy requires a promoter

Journal Pre-proof

with optimal transcriptional activity for cell-type specificity.

The principle of AAV-TAREGET for cell-type-selective experiments is applicable to

Cre-lox system under the sparser labeling condition

Since the Cre-lox recombination system is well established in neuronal experiments,

most of the current AAVs are designed to use FLEX (FLip-EXcision) switches also

referred to as Double-floxed Inverted Open reading frame (DIO) systems

. To assess the

potential applicability of already available AAVs carrying DIO systems, we tested the

compatibility of Cre-lox recombination with the principle of restricted gene expression

using the TAREGET strategy instead of the Tet-Off system. We then replaced the

transactivator tTA with Cre recombinase and the tTA-dependent reporter AAV with Cre-

dependent reporter AAV (

Figure 3A

). To minimize the leaky expression of Cre

recombinase, we compared two types of Cre: codon-improved Cre recombinase (iCre)

and destabilized iCre (diCre), the latter of which has a protein degradation signal

at the

C-terminal of iCre. As a result of immunohistochemical verification, diCre-mediated

labeling showed more selective localization of fluorescent signals in the NP1-positive

area than iCre (

Figures 3B, 3C, and S5A

). However, only 32.1% of mNG-positive cells

expressed NP1, suggesting that leaky diCre expression in other cell types, although non-

selective labeling of AVP-positive neurons was significantly suppressed by using diCre

compared to iCre (

Figures 3D, 3E, and S5B

). Optimization of the viral titer (1:100

dilution of diCre-driver AAV) improved the specificity of mNG expression in OXT

neurons (83.1%;

Figures S4C and S5D

); however, its labeling efficiency decreased to

51.0% (

Figure S5E

). Therefore, the application of the TAREGET strategy to the Cre-lox

system should be carefully considered, although cell-type selectivity and sparse labeling

can be achieved by viral titer optimization. We conclude that the Tet-Off system is more

suitable for selective and efficient gene expression in dual-AAV-based cell-type-selective

labeling.

Journal Pre-proof

AAV TAREGET for OXT neurons enables efficient axonal labeling of OXT neurons

throughout the whole brain in mice

Next, we aimed to determine a fine circuit structure of PVH-OXT neurons in mice

using AAV TAREGET-OXT. Although the wiring diagram of OXT neurons has recently

been documented in detail using OXT-Cre mice

50,51

, a non-transgenic approach will help

understand the extent to which OXT circuitry is conserved across species and altered in

animal models of neuropsychiatric disorders.

To visualize the axonal projections of OXT neurons, we used pal-mScarlet, a bright

monomeric red fluorescent protein mScarlet

fused to the membrane-targeting

palmitoylation domain of growth-associated protein 43 (GAP43)

44,53,54

. A cocktail of

AAV-mOXT-tTA and AAV-TRE-pal-mScarlet was injected into the PVH of wild-type

mice (

Figures 4A and 4B

). Mapping of axonal projection was conducted using a

microscopic whole-brain imaging system FAST (block-FAce Serial microscopy

Tomography), which we have previously developed for brain-wide structural analysis at

a subcellular resolution

55,56

. Approximately 300 cells (302

49 cells) in the PVH were

labeled with pal-mScarlet along the anteroposterior axis (

Figure S6A

), and ectopic

expression was not observed throughout the brain. Extensive axonal projections were

observed in the subcortical area and brain stem, whereas fewer fibers were detected in the

cerebral cortex (

Figures 4C and 4D

), which is consistent with previous reports on OXT-

Cre mice

50,51

. To verify the cell type of pal-mScarlet-expressing cells, we also performed

post-hoc immunohistochemical analysis after FAST imaging and found that the

selectivity for OXT neurons was maintained at over 90% (

Figures 4E–G and S6B

These results suggest that the TAREGET strategy allows enhanced gene expression

sufficient for brain-wide axonal labeling with cell-type specificity and may be applicable

to a wide variety of cell-type-selective experiments in not only normal animals but animal

models of brain disorders.

Journal Pre-proof

Application of the TAREGET strategy in labeling dopaminergic and serotonergic

neurons

Next, we applied the TAREGET strategy to genetic labeling of other cell types,

dopaminergic neurons in the ventral tegmental area (VTA) and serotonergic neurons in

the dorsal raphe nucleus (DRN), using the previously reported 2.6 kb length of mouse

tyrosine hydroxylase promoter (mTHp)

and 2.0 kb length of mouse tryptophan

hydroxylase 2 promoter (mTPH2p)

58,59

, respectively. Although these promoters have

already been established, we examined whether the combination of these promoters and

the TAREGET strategy could maintain specificity and efficiency.

We then compared the mTHp-based TAREGET system (TAREGET-TH) and two

single AAV systems carrying mTHp with 5’ inverted WPRE (IW) or 3’ WPRE (W) at two

viral doses (

Figure 5A

). Apparent leaky expression in TH-negative cells was observed in

all the viral constructs with higher viral doses (

Figures 5B and 5C

). The reduction in the

injected viral doses dramatically decreased the number of mNG-positive cells in both

single AAV systems (

Figures 5D and S7

). However, the TAREGET-TH at 1 × 10

vg of

each AAV maintained labeling efficiency in the TH-positive neurons (89.2%) and

exhibited 92.1% specificity to dopaminergic neurons (

Figure 5D

Next, we evaluated the specificity and efficiency of the mTPH2p-based TAREGET

system (TAREGET-TPH2) by comparing with single AAV systems carrying mTPH2p

(

Figure S8A

). In contrast to the findings in dopaminergic neurons, the mTPH2p exhibited

high specificity across examined AAV constructs, although the higher viral dose of

TAREGET-TPH2 showed a slight reduction in specificity (76.1% specificity to TPH2-

positive neurons) relative to other conditions (

Figures S8B and S8C

). However, the

efficiency of labeling and the number of cells expressing mNG varied depending on the

viral dose and the expression systems, with TAREGET-THP2 showing a significant

increase in efficiency compared to the single AAV systems (

Figures S8D–F

). Thus,

Journal Pre-proof

TAREGET-TPH2 can be used for the labeling of serotonergic populations with wide

coverage.

These results suggest that the TAREGET strategy is compatible with mTHp and

mTPH2p and has advantages in specificity and efficiency compared to single AAV

systems, although the dose of the virus should be carefully considered depending on the

type of experiment.

Cell-type-specific CRISPR-mediated gene editing using the TAREGET system.

The potential advantage of the TAREGET system is its applicability for the expression

of larger genes within the limited AAV packaging capacity, owing to the compact size of

the TRE promoter (approximately 320 bp) relative to other promoters (e.g. 2.6 kb of

mTHp and 2.0 kb of mTPH2p). Therefore, we examined the cell-type-specific expression

of Staphylococcus aureus Cas9 (saCas9; 3.3 kb including nuclear localization signals and

HA tags)

in wild-type mice and conducted gene inactivation via CRISPR-mediated

mutagenesis

using the TAREGET system. The expression of saCas9 was driven under

the control of CMV promoter or the TAREGET-TH system and compared to the

TAREGET-TH without a TRE-saCas9 vector (tTA only) (

Figure 6A

). To determine the

efficiency of CRISPR-mediated knockdown at protein levels in the targeted cell type, we

generated a single guide RNA (sgRNA) targeting the

Rbfox3

(NeuN) gene, which is a

neuron-specific protein localized in nuclei and perinuclear cytoplasm

(

Figure 6A

Specific and efficient expression of HA-tagged saCas9 in the TH-positive population

was achieved using the TAREGET-TH system (

Figures 6B–D

). The CMV-saCas9 vector

resulted in a reduction of NeuN immunofluorescence in both the TH-positive and TH-

negative area consistent with its non-specific expression of saCas9, whereas TAREGET-

TH-mediated saCas9 expression attenuated the NeuN immunofluorescence in the TH-

positive cells specifically (

Figure 6B

). The fluorescence intensity of NeuN in TH-positive

cells was significantly decreased by saCas9-expressing vectors compared to the tTA-only

Journal Pre-proof

negative control (

Figure 6E

), suggesting the efficient knockdown of NeuN via CRISPR-

mediated mutagenesis. These results indicate that cell-type-specific genome editing in

wild-type mice can be achieved using the TAREGET system.

Discussion

In the present study, we propose an AAV system for cell-type-selective gene delivery

in wild-type animals, named TAREGET. The main principle of AAV TAREGET is tight

but efficient control of gene expression in the targeted cell population using an inverted

WPRE, a cell-type-selective promoter, and a Tet-Off system. The use of binary expression

systems, such as the Cre-lox and Tet-Off systems, has become widespread and prevalent

in transgenic animals

, but these are less established in viral-genetic approaches carrying

tTA or Cre driver genes. The limited utility of AAV vectors is partially due to non-specific

labeling caused by leaky background expression of driver genes. In binary approaches,

reporter gene expression can be induced by the leaky and weak expression of driver genes,

which is attributed to the insufficient specificity of the cell-type-targeting promoter, non-

specific ITR promoter activity

37,38

, or a high copy number of infected AAV vectors

Insufficient regulation of driver gene expression can also lead to toxic effects, as observed

with extremely high levels of transgene expression induced by the tTA-WPRE

combination (

Figure S1

). Overall, our results suggest that the TAREGET system can be

used for achieving appropriate levels of transgene expression with cell-type specificity,

labeling efficiency, and less cytotoxicity. Furthermore, the TAREGET strategy allowed

cell-type specific and efficient expression in multiple cell types: oxytocinergic,

dopaminergic, and serotonergic neurons. These results suggest that the TAREGET system

has potential for broader application in other cell-type-selective promoters in AAV vectors.

An additional advantage of the dual AAV system is its greater packaging capacity

compared to a single AAV system. The packaging capacity of AAV, typically 4.7 kb, limits

the inclusion of large cell-type-specific promoters along with large transgenes. In contrast,

Journal Pre-proof

the compactness of the TRE promoter in the Tet-Off-based dual AAV system allows for

the use of a large part of the limited packaging capacity for the transgene, as previously

applied to express saCas9 depending on neuronal activation

. Although the advantage of

increased transgene capacity is a common feature among AAVs equipped with the TRE

promoter, the TAREGET system enhances cell-type specificity and ensures extensive

coverage within targeted cell types for long transgenes. Thus, the TEREGET system not

only refines specificity for targeted cell types but also expands the variety of experiments

for cell-type-selective manipulation in neuroscience, including gene editing. Furthermore,

given that the TAREGET system is compatible with expression logics using Cre and Flp

recombinases, it enables molecular and cellular interventions in complex cell subtypes,

including genetically and/or anatomically defined subpopulations.

Experimental conditions, such as AAV capsid serotypes and application to reporter

mouse lines should be carefully considered; different conditions may result in different

outcomes. Studies of high-quality single-cell ATAC sequencing have identified cell-type-

or subclass-specific enhancers

19,20

, and one of these studies showed that some cell-type-

specific enhancer AAVs carrying tTA resulted in sparse labeling

. Although the target

cell types differed across studies, the labeling efficiency may be influenced by

methodological diversities in the AAV capsid serotypes (e.g., serotype 9 vs. PHP.eB),

routes of viral administration (e.g., stereotaxic injection vs. intravenous administration),

and reporter systems (e.g., reporter AAV vs. reporter mouse line). This concern is partially

supported by a study showing that the use of different serotypes results in different

specificities of labeling in noradrenergic neurons, probably due to differences in

transduction efficiency

. Indeed, TAREGET AAVs for serotonergic and dopaminergic

neurons require optimization of transduction efficiency by adjusting viral doses. Thus, we

should note that the selectivity and completeness of labeling may depend not only on

promoter and regulatory elements of the recombinant AAV genome, but also on the

infection efficiency and reporter systems employed. Conversely, the TAREGET strategy

Journal Pre-proof

may provide different results with improved specificity and efficiency and has the

potential to renew the previously identified enhancers or promoters used in conventional

AAV systems.

The PVH and supraoptic nucleus (SON) are the major sources of OXT, not only for

peripheral release but also for the central nervous system

. OXT is released from the

axonal and somatodendritic processes

and modulates neuronal activity in target brain

regions via OXT receptor

. The distribution of OXT receptors and OXT-neuronal axons

has been reported to have discrepancies, such that the OXT receptor is expressed in

neurons in a wide range of cortical regions, but few axons from OXT neurons in the PVT

and SON are detected in the cortex

. In the present study, we applied the AAV

TAREGET-OXT to brain-wide axonal mapping to examine whether we could obtain

results similar to those of previous studies using OXT-Cre mice and whole-brain imaging.

Consistent with previous studies, dense axonal projections from the PVH were observed

mainly in the hypothalamus, midbrain, and hindbrain. The OXT projection to the cortical

area was quite sparse, although we employed a membrane-tagged fluorescent protein for

better axonal transports

44,54

and higher-resolution imaging conditions (1 × 1 μm for lateral

resolution and 5 μm for axial resolution) for comprehensive mapping of axons throughout

the entire cortex. These results may support the idea from previous studies that OXT can

act on OXT receptor-expressing cortical neurons via the cerebrospinal fluid

. Dense

OXT projections adjacent to the ventricles (dorsal and ventral parts of the third ventricle,

fourth ventricle, and cerebral aqueduct;

Figure 4D

) may support the release of OXT into

the cerebrospinal fluid, as suggested in a previous report

. These alternative tools for

cell-type-specific approaches allow the fine structural analysis of specific cell types in a

variety of mouse models without using Cre-driver mouse lines.

Limitations of the study

In the present study, we optimized the combination of regulatory components in

Journal Pre-proof

recombinant AAV vectors to establish selective and efficient transduction in targeted

neuronal populations. The main limitations of the TAREGET system are (1) the necessity

to use two distinct vectors in a precise ratio, and (2) the necessity of inherently cell-type-

specific promoters. Therefore, pilot experiments are required to achieve specific and

efficient expression, and those can limit the applicability and translatability of the

TAREGET system to other species. Despite these limitations, our study empirically and

quantitatively demonstrated that cell-type specificity and efficiency of gene expression

can be enhanced by modifying gene regulatory elements other than promoters. These

methodologies and the potential characteristics of AAV vectors can be essential

information for guiding reproducible experiments and their translational applications.

For practical concerns for the use in basic animal research, we have not examined the

cell-type selectivity of TAREGET AAVs in unintended other brain regions, such as the

cortical or thalamic areas, where oxytocinergic, serotonergic, and dopaminergic neurons

are not located. Therefore, we could not exclude the potential ectopic expression when

TAREGET AAVs were applied to unintended brain regions by widespread transduction,

such as AAV2-retro-mediated retrograde transduction

and PHP.eB capsid-mediated

brain-wide transduction

57,70

. Ectopic expression can be induced by the TRE promoter

itself in a doxycycline-independent manner

. Some genes contain transcription factor

recognition sequences in their protein coding sequence themselves

, and those may

enhance tTA-independent expression. These factors in the TRE promoter system can

affect the functionality of AAV TAREGETs. Therefore, users must carefully examine cell-

type specificity and efficiency when the TAREGET system is applied to expressing other

genes of interest that we have not examined.

Supplemental information

Supplemental information can be found online.

Journal Pre-proof

Acknowledgements

This work was supported in part by JSPS KAKENHI Grant Numbers, JP23H00395

(H.H.), JP20H00492(H.H.), JP20H03556 (K.S.), and JP22K19481 (K.S.); AMED Grant

Numbers, JP21dm0207117(H.H.), JP23ama121052 (H.H.), JP23ama121054 (H.H.),

JP21wm0525005 (K.S.), JP19gm1310003 (T.N.), and JP21wn0425012 (T.N.); JST,

PRESTO Grant Number JPMJPR23S7 (K.S.).

Author contributions

Conceptualization, K.S. and H.H.; Methodology, K.S.; Formal Analysis, L.K. and K.S.;

Investigation, L.K., K.S., and H.R.; Resources, L.K., K.S., and H.R.; Writing

– Original

Draft, L.K. and K.S.; Writing – Review & Editing, K.S., T.N., A.K., and H.H.;

Supervision, K.S. and H.H.; Funding Acquisition, K.S., T.N., A.K., and H.H.

Declaration of Interests

The authors declare no competing interests.

Figure legends

Figure 1. Optimization of the expression control system and regulatory component

in recombinant AAV genomes using OXT promoter.

(A) Scheme of the experimental paradigm. C57BL/6N mice received stereotaxic injection

of AAVs into the bilateral PVH regions. (B) AAV vector constructs and representative

images of the PVH transduced by each AAV set. All images were obtained and presented

with the same imaging and contrast conditions except for the mNG-channel in AAV set

#7, because AAV set #7 induced high levels of mNG expression, and thereby single cells

could not be identified due to signal saturation. Scale bar, 200 µm. (C) Quantitative

analysis of specificity to the OXT neurons. Percentage of the number of mNG and NP1

(OXT neuronal marker) double-positive cells to that of mNG-positive cells was quantified.

(D) Quantitative analysis of efficiency of gene expression in the OXT neurons.

Journal Pre-proof

Percentage of the number of mNG and NP1 double-positive cells to that of NP1-positive

cells was quantified. For C and D, the number on the vertical axis is corresponding to the

number of AAV sets shown in B. PVH, paraventricular hypothalamic nucleus; IHC,

immunohistochemistry; NP1, Neurophysin 1; AVP, arginine vasopressin; ITR, inverted

terminal repeat; mOXTp mouse oxytocin promoter; mNG, mNeonGreen; WPRE,

woodchuck hepatitis virus post-transcriptional regulatory element; polyA,

polyadenylation signal; tTA, tetracycline transactivator; TRE, tetracycline response

element. Statistical analysis was performed excluding groups in which mNG-positive

cells were not detected. Point plots in C and D represent the quantified values per brain

hemisphere (typically 6 regions from 3 mice). *p < 0.05; **p < 0.01; ***p < 0.001; ****p

< 0.0001; n.s., not significant. Statistical significance is shown only for the comparisons

between AAV set #8 (TAREGET-OXT) and other groups to avoid redundancy. Full

statistics are shown in Table S1. Data are represented as mean ± SEM. See also Figure

S1.

Figure 2. AAV TAREGET allows specific gene expression in OXT neurons but

requires optimization of promoter activity.

(A) Scheme of AAV vector constructs to compare two types of mOXT promoter (1.0 kb

and 2.6 kb) in the AAV TAREGET system. (B) Representative images of the PVH

immunostained for NP1 (OXT neuron). (C) Quantitative comparison of specificity to the

OXT neurons. The value of the 1.0 kb OXT promoter in Figure 1 was indicated for

comparison. (D) Representative images of the PVH immunostained for AVP. (E)

Quantitative comparison of leaky expression of mNG in the AVP neurons. Scale bars, 200

µm. ***p < 0.001; ****p < 0.0001. Data are represented as mean ± SEM. See also Figures

S2 and S3.

Figure 3. TAREGET strategy has greater suitability for the Tet-Off system

Journal Pre-proof

compared to the Cre-lox expression system in OXT neurons.

(A) Scheme of AAV vector constructs utilizing iCre or destabilized iCre (diCre) in the

AAV TAREGET system. AAV9-EF1

-DIO-mNG was used as a reporter system. (B)

Representative images of the PVH immunostained for NP1 (OXT neuron). (C)

Quantitative comparison of specificity to the OXT neurons. The value of the tTA-

mediated labeling specificity in Figure 1 was indicated for comparison. (D)

Representative images of the PVH immunostained for AVP. (E) Quantitative comparison

of leaky expression of mNG in the AVP neurons. The value of the tTA-mediated leaky

expression in Figure 2 was indicated for comparison. Scale bars, 200 µm. ***p < 0.001;

****p < 0.0001; n.s., not significant. Data are represented as mean ± SEM. See also

Figure S4.

Figure 4. AAV TAREGET-OXT allows robust reporter gene expression to visualize

axonal fibers throughout the whole brain in wild-type mice.

(A) Scheme of the AAV TAREGET vector constructs and experimental paradigm. AAVs

were injected into the unilateral PVH region of mice at the viral dose of 3×10

viral

genome. Whole-brain imaging was performed using FAST, and coronal sections after

FAST imaging were collected and subjected to post-hoc immunohistochemical analysis

to verify the OXT neuron-selective expression. (B) Representative images of coronal

section (left) and magnification of the PVH outlined with a magenta box (right). (C) The

3D-rendered images of the whole brain. The color scale represents the fluorescent

intensity for the pal-Scarlet. The dim violet signal is the autofluorescence emitted from

the brain parenchyma. (D) Representative images of axonal fibers in various brain regions.

(E) Representative images of the post-hoc immunohistochemical analysis after FAST

imaging. (F) Validation for the specificity of pal-Scarlet expression to the OXT neurons.

(G) Validation for efficiency of pal-Scarlet expression in the OXT neurons. The pal-

Scarlet expression was examined at 2 and 3 weeks after viral injection (E and F). NTS,

Journal Pre-proof

nucleus tractus solitarius; DMX, dorsal motor nucleus X; LC, locus coeruleus; PBN,

parabrachial nucleus; DRN, dorsal raphe nuclei; PAG, periaqueductal gray; VTA ventral

tegmental area; SN, substantia nigra; PVT, paraventricular nucleus of the thalamus; ACB,

nucleus accumbens; A, anterior; L lateral; V, ventral. Scale bars, 1 mm (the left panel in

B and C) and 200 µm (the magnified view in B, D, and E). See also Figure S5.

Figure 5. Application of the TAREGET strategy for labeling other cell types.

(A) Scheme of the AAV vector constructs for selective gene expression in dopaminergic

neurons within the VTA using the mTH promoter. (B) Representative images of the VTA

immunostained for TH (dopaminergic neurons). Each AAV group was injected at two

different viral doses indicated in (A) into the VTA per side. (C) Quantification of the

specificity of mNG expression for dopaminergic neurons. Percentage of mNG and TH

double-positive cells among mNG-positive cells was quantified. (D) Quantification of the

efficiency of mNG expression in dopaminergic neurons. Percentage of mNG and TH

double-positive cells among TH-positive cells was quantified. VTA, ventral tegmental

area. Scale bar, 200 µm (B, the left image in the overlays) and 500 µm (B, the right image

in the overlay). ***p < 0.001; p<0.0001****. Statistical significance is shown only for

the comparisons between the optimized TAREGET-TH (10

vg) and other groups to avoid

redundancy. Full statistics are shown in Table S1. Data are represented as mean ± SEM.

See also Figures S6–S8.

Figure 6. Application of the TAREGET system for cell-type-specific CRISPR-

mediated gene knockdown.

(A) Scheme of the AAV vector constructs to evaluate knockdown of NeuN via CRISPR-

mediated mutagenesis. The TAREGET-TH tTA-only group was used as a negative control

that does not affect NeuN expression. The guide and protospacer adjacent motif (PAM)

sequences for the mouse

Rbfox3

(NeuN) gene were indicated in the right panel. Viruses

Journal Pre-proof

were injected into the VTA per side. (B) Representative images of the VTA

immunostained for HA-tag (saCas9), TH (dopaminergic neurons), and NeuN (neuronal

marker). (C) Quantification of the specificity of HA-tagged saCas9 expression to

dopaminergic neurons. Percentage of HA and TH double-positive cells among HA-

positive cells was quantified. (D) Quantification of the efficiency of HA-tagged saCas9

expression in dopaminergic neurons. Percentage of HA and TH double-positive cells

among TH-positive cells was quantified. (E) Quantification of NeuN

immunofluorescence intensity in TH-positive cells relative to the tTA-only group. Scale

bar, 100 µm (B, the upper image in the overlay of TAREGET-TH::saCas9) and 25 µm (B,

the lower image in the overlay of TAREGET-TH::saCas9). p<0.0001****. Data are

represented as mean ± SEM.

STAR Methods

Lead contact

Further information and requests for resources and reagents should be directed to and will

be fulfilled by the lead contact, Kaoru Seiriki (seiriki@phs.osaka-u.ac.jp)

Materials Availability

Plasmids generated in this study will be available by the lead contact upon request.

Data and Code Availability

•

All data reported in this paper will be shared by the lead contact upon request.

•

This paper does not report original code.

•

Any additional information required to reanalyze the data reported in this paper is

available from the lead contact upon request.

Journal Pre-proof

Experimental Model and Study Participant Details

Animals

All animal care and handling procedures were approved by the Animal Care and Use

Committee of Osaka University (approval number R02-8-7). All efforts were made to

minimize the number of animals used. Male C57BL/6N or C57BL/6J mice (SLC,

Shizuoka, Japan) aged 7–14 weeks were used throughout this study. The mice were

maintained in group housing (three–six mice per cage), except for singly housed mice.

They were kept on a 12-hour light-dark cycle (lights on at 8:00 a.m.) with controlled room

temperature and humidity. Water and food (CMF, Oriental Yeast, Osaka, Japan) were

available ad libitum.

Cell lines

Lenti-X 293T cells (632180, Clontech) were used to produce the AAV. Cells were

cultured in Dulbecco’s modified Eagle’s medium with high glucose and GlutaMAX

supplement (DMEM, high glucose, GlutaMAX™ Supplement; 10566024, Thermo Fisher

Scientific) containing 10% fetal bovine serum (Sigma-Aldrich) at 37°C with 5% CO

METHOD DETAILS

Plasmid construction

A plasmid editor (ApE)

was used for designing the plasmids. For AAV TAREGET-OXT

plasmid construction, the tTA advanced and SV40 polyadenylation signal sequences were

cloned by PCR amplification from the pTet-Off Advanced vector (631070, Clontech) and

inserted into a linearized pAAV-TRE-DIO-FlpO

(Addgene #118027) backbone

(digested with HindIII and MluI) using an In-Fusion cloning system (639650, Clontech).

The residual hGH polyadenylation signal in the plasmid backbone was removed by

digestion with BstEII and BglII, followed by blunt endings and self-ligation. The resulting

Journal Pre-proof

plasmid had a promoterless TAREGET backbone, pAAV-inverted WPRE (IW)-tTA-pA.

The 1.0 kb

and 2.6 kb

lengths of mOXTp were cloned by PCR amplification using

pAAV-mOXT-hM3Dq-mCherry

(#70717, Addgene) and C57BL/6J mouse genomic

DNA, respectively, and inserted into the TAREGET backbone using the In-Fusion system.

For TAREGET-TPH2 and TAREGET-TH plasmid construction, the 2.0 kb length of

mTPH2p

58,59

and the 2.6 kb length of mTHp

were cloned by PCR amplification using

C57BL/6J mouse genome DNA and inserted into the TAREGET backbone in the same

way as the TAREGET-OXT. The other plasmids shown in Figure 1 (plasmids for OXT

neurons), 5 (plasmids for dopaminergic neurons), and S8 (plasmids for serotonergic

neurons) were prepared from pAAV-mOXT-hM3Dq-mCherry, pAAV-TRE-

mNeonGreen

(#99131, Addgene), and plasmids for TAREGET AAVs carrying mOXTp,

mTHp, and mTPH2p, using basic subcloning techniques. For Cre-driver plasmid

construction, tTA in the AAV TAREGET-OXT (pAAV-IW-mOXT-tTA) was removed

using EcoRI and BamHI, and iCre or iCre together with the degradation signal CL1-PEST,

which was cloned by PCR from the pAAV-Fos-dER

CreER

plasmid

, waw inserted

using the In-Fusion system. To construct pAAV-EF1-DIO-mNeonGreen, pAAV-EF1-

DIO-hM3Dq-mCherry (#50460, Addgene) and pAAV-CAG-fDIO-mNeonGreen

(#99133, Addgene) were digested using AscI and NheI, and the mNeonGreen DNA

fragment was inserted into the linearized pAAV-EF1-DIO vector. To construct pAAV-

TRE-pal-mScarlet-WPRE, mScaelet was cloned and fused to the C-terminus of the

GAP43 palmitoylation domain by PCR amplification using pAAV-CaMKIIa-mScarlet

(#131000, Addgene) and a primer with an additional sequence encoding the GAP43

palmitoylation domain as previously described

. The pal-mScarlet PCR amplicon was

inserted into the linearized pAAV-TRE vector (pAAV-TRE-mNeonGreen digested with

KpnI and EcoRI) using the In-Fusion system. To construct pAAV-CMV-saCas9-U6-

sgNeuN, the guide sequence for sgRNA targeting mouse NeuN (

Rbfox3

), 5’-

CGCCTCAGAATGGAATCCCAG-3’ was designed using the Benchling CRISPR Guide

Journal Pre-proof

RNA Design tool (https://www.benchling.com/crispr). The pAAV-CMV-saCas9-U6-

BsaI-sgRNA (#61591, Addgene) was digested with BsaI, and synthesized

oligonucleotides (the guide sequence with complementary sequences to the overhangs

generated by BsaI digestion) were inserted by ligation. To further construct pAAV-TRE-

saCas9-U6-sgNeuN, the mNeonGreen gene and WPRE sequence in the pAAV-TRE-

mNeonGreen was replaced with saCas9-U6-sgNeuN in the pAAV-CMV-saCas9-U6-

sgNeuN via restriction enzyme digestion with NcoI and PvuI followed by ligation.

Viral vector production and purification

AAV vectors were produced using the helper-free triple transfection procedure, as

described previously

with minor modifications. Briefly, an AAV transgene plasmid was

transfected into Lenti-X 293T cells using polyethyleneimine (PEI MAX; 24765,

Polyscience Inc.) with a pAAV2/9n plasmid (#112865, Addgene), which supplied AAV2

replication proteins and AAV9 capsid proteins, and a pHelper plasmid, which supplied

the adenovirus gene products required for AAV production. Cells were harvested 72 h

after transfection and suspended in a buffer containing 100 mM Tris (pH 7.6), 100 mM

MgCl2, and 500 mM NaCl. The cell suspension was subjected to three freeze-thaw cycles

and treated with ≥250 U/µL of Benzonase nuclease (Sigma-Aldrich, St Louis, MO) at

37℃ for at least 40 min. The suspension was centrifuged at 3,000 ×

for 15 min at 4℃,

and the supernatant was loaded onto an iodixanol step gradient (15, 25, 40, and 60%;

Optiprep, Cosmo Bio) and centrifuged at 278,400 ×

for 105 min at 18℃. After

centrifugation, the 40/60% interface and the 40% layer containing AAV vectors were

collected and replaced with D-PBS containing 0.001% (v/v) Pluronic F-68 via

ultrafiltration using an Amicon Ultra-15 centrifugal filter (100-kDa cutoff; UFC910024,

Millipore) to concentrate the AAV vectors. The titer of AAV was quantified using a

quantitative real-time polymerase chain reaction with GoTaq qPCR Master Mix (Cat#

A6001, Promega), with a linearized AAV genome plasmid serving as a standard.

Journal Pre-proof

Stereotaxic surgery

Mice were deeply anesthetized by intraperitoneal injection of an anesthetic cocktail

containing 0.75 mg/kg medetomidine (Nippon Zenyaku Kogyo, Fukushima, Japan), 4

mg/kg midazolam (Sandoz Pharma, Basel, Switzerland), and 5 mg/kg butorphanol (Meiji

Seika Pharma, Tokyo, Japan) and placed in a stereotaxic instrument (RWD Life Science

Co., LTD, San Diego, CA). The AAV vectors were injected into the bilateral or unilateral

PVH (anteroposterior (AP) −0.7 mm, mediolateral (ML) ±0.3 mm, dorsoventral (DV)

−5.0 mm to −5.2 mm from the bregma), the DRN (AP −4.6 mm, ML 0.0 mm, DV −3.3

mm from the bregma with 20°-angled injection), and the VTA (AP −3.6 mm, ML ±0.6

mm, DV −4.6 mm from the bregma) using a Neuros Syringe with a 33-gauge needle

(Hamilton, Reno, NV) and an UltraMicroPomp3 with SMARTouch Controller (World

Precision Instruments) at a rate of 100 nL/min. For TAREGET-OXT AAVs, each AAV set

was injected at doses of 1 × 10

and 3 × 10

vg (viral genomes) per side, as shown in

Figures 1–3 and Figure 4, respectively. For AAVs carrying the mTHp and mTPH2p, each

single AAV was injected at two doses: 1 × 10

vg and 1 × 10

vg, and the TAREGET-TH

AAV cocktail (tTA driver AAV : TRE reporter AAV) was injected at two ratios: 1 × 10

vg with 1 × 10

vg, and 1 × 10

vg with 1 × 10

vg per side. For TAREGET-TPH2, the

AAV cocktail (tTA driver AAV : TRE reporter AAV) was injected at two ratios: 1 × 10

vg with 1 × 10

vg, and 1 × 10

vg with 1 × 10

vg. The needle was kept in place for 3

min before being slowly removed to avoid backflow. Following stereotaxic surgery, the

mice received an intraperitoneal injection of atipamezole (0.75 mg/kg; Nippon Zenyaku

Kogyo) and gentamicin (10 mg/kg; Sigma-Aldrich) immediately. One day after the

surgery, an intraperitoneal injection of buprenorphine (0.1 mg/kg; Otsuka Pharma, Tokyo,

Japan) was administered to relieve pain.

Tissue preparation

Journal Pre-proof

Mice were deeply anesthetized by intraperitoneal injection of an anesthetic cocktail

containing medetomidine (0.75 mg/kg), midazolam (4 mg/kg), and butorphanol (5

mg/kg). Anesthetized mice were transcardially perfused with saline followed by 4%

paraformaldehyde (Nacalai Tesque, Kyoto, Japan) dissolved in phosphate-buffered saline

(PBS). Brain tissues were excised and immersed in a 4% paraformaldehyde solution until

use. For immunohistochemical analysis, fixed brains were cryoprotected in 20% (w/v)

sucrose dissolved in PBS for two days, embedded in OCT compound (Sakura Finetek)

and quickly frozen on liquid nitrogen. For whole-brain imaging, fixed brains were

embedded in 4% (w/v) agarose gel.

Immunohistochemical analysis

Brain tissues were sliced into 25-µm-thick coronal sections using a cryostat. Serial

sections were alternately and separately collected into two groups (e.g., 20–30 sections

from one brain per group for the PVH). For immunohistochemical analysis of the PVH,

one group of sections was used for immunostaining for NP1, and the other was used for

immunostaining for AVP, as necessary. For the immunohistochemical analysis of the

DRN and VTA, only one group of sections was used for immunostaining. In the post-hoc

immunohistochemical analysis after whole-brain imaging in Figure 4, the 50-µm-thick

coronal sections after FAST imaging were collected (see also Whole-brain imaging

method section). The sections were subjected to conventional free-floating staining.

Briefly, sections were incubated with 1% bovine serum albumin (Nacalai Tesque)

dissolved in PBS containing 0.3% (v/v) Triton X-100 (Nacalai Tesque) for 1 hour at room

temperature for blocking and permeabilization.

To determine the cell type expressing fluorescent proteins, sections were stained by

following procedures. For the primary antibody reaction, sections were incubated with

mouse anti-NP1 monoclonal antibody (1:1,000 dilution; cat#

MABN844, Merck

Millipore), rabbit anti-AVP polyclonal antibody (1:1,000 dilution; cat#

ab213708, abcam),

Journal Pre-proof

rabbit anti-TPH2 polyclonal antibody (1:1000 dilution; cat# NB100-74555, Novus

Biologicals) or chicken anti-TH polyclonal antibody (1:1000 dilution; cat# ab76442,

abcam) overnight at room temperature. For the secondary antibody reaction, the sections

were incubated with Alexa 568-conjugated goat anti-mouse or anti-rabbit

immunoglobulin G (IgG), Alexa 568-conjugated goat anti-chicken immunoglobulin Y

(IgY), or Alexa 488-conjugated goat anti-mouse IgG antibodies (1:1,000 dilution; cat#

ab175473, ab175471, ab175477 and ab150113, respectively, abcam) for 2 h at room

temperature. For the evaluation of cell death induction, rabbit anti-cleaved caspase-3

antibody (1:400 dilution; cat# 9661S, Cell Signaling Technology) and Alexa 568-

conjugated goat anti-rabbit IgG antibody (1:1,000 dilution) were used with mouse anti-

NP1 and Alexa 647-conjugated goat anti-mouse IgG antibodies (cat# ab150115 for

secondary antibody, abcam). For the knockdown experiment using AAVs carrying the

saCas9 gene, sections were stained as follows. For the primary antibody reaction, sections

were incubated with mouse anti-HA-tag monoclonal antibody (1:1,000 dilution; cat#

M180-3, MBL, Tokyo, Japan), rabbit anti-NeuN monoclonal antibody (1:500 dilution;

cat# ab177487, abcam), and chicken anti-TH polyclonal antibody (1:1,000 dilution; cat#

ab76442, abcam) overnight at room temperature. For the secondary antibody reaction,

sections were incubated with Alexa 488-conjugated goat anti-mouse IgG, Alexa 568-

conjugated goat anti-rabbit IgG, and Alexa 647-conjugated goat anti-chicken IgY

antibodies (1:1,000 dilution; ab150113, ab175471, and ab150171, respectively, abcam)

for 2 h at room temperature. Tissue sections with following AP coordinates were imaged

for quantification of fluorescence-positive cells using a fluorescence microscope (BZ-

X810, Keyence): AP −1.2 mm to 0 mm for the PVH; AP −4.7 mm to −4.0 mm for the

DRN; and AP −3.7 mm to −3.3 mm for the VTA. The number of fluorescence-positive

cells in the field of view (FOV; 1.08 mm × 1.44 mm) including the PVH, DRN, and VTA

was manually counted using ImageJ/FIJI

. Specificity, efficiency, and leakage were

calculated for each injection site, and cells in the bilateral PVH and VTA were counted

Journal Pre-proof

separately. The immunofluorescence intensity of NeuN in dopaminergic neurons was

quantified using ImageJ/FIJI as follows: (1) the region of interest (ROI) mask for TH-

positive cells were generated using background subtraction and binarization by

brightness-thresholding, and (2) the fluorescence intensity of immunolabeled NeuN per

TH-positive ROI area was measured.

Whole-brain imaging and data processing

Whole-brain imaging was performed using a high-speed serial-section imaging system,

FAST, which was developed in previous studies

55,56

. Briefly, brain tissue blocks

embedded in a 4% agarose gel were placed in the sample chamber of the FAST system.

Brain section images were acquired as a mosaic of fields of view with 20% overlap in the

x-y plane and 25-µm overlap in the z-direction, with a resolution of 1.0 µm × 1.0 µm ×

5.0 µm. We acquired images with two color channels: red fluorescence excited by a 561

nm laser and green autofluorescence excited by a 488 nm laser. The x-y plane section

images were reconstructed by overlapping the alignment of consecutive sections using a

previously reported stitching program, FASTicher

, with minor modifications in Python

3.8. Reconstructed serial section images were downsized to 5.0 µm × 5.0 µm × 50 µm

and exported to Imaris software (Bitplane) for three-dimensional volume rendering.

QUANTIFICATION AND STATISTICAL ANALYSIS

All data are presented as the mean

SEM. Statistical analyses were conducted on R

using the following functions: var.test(), t.test(), bartlett.test(), oneway.test(), and

pairwise.t.test(). For two-group comparisons, the F-test was used to assess the equality of

variances, and the unpaired Student’s t-test or Welch’s t-test was used, depending on the

equality of variances. For multiple comparisons, equality of variances was examined by

the Bartlett test, and statistical significance was evaluated by one-way ANOVA followed

by the Holm-Bonferroni test or Welch’s ANOVA followed by Welch’s t-test with Holm

Journal Pre-proof

References

1. Zeng, H., and Sanes, J.R. (2017). Neuronal cell-type classification: challenges,

opportunities and the path forward. Nat. Rev. Neurosci.

, 530–546.

2. Zeng, H. (2022). What is a cell type and how to define it? Cell

185

, 2739–2755.

3. Taniguchi, H., He, M., Wu, P., Kim, S., Paik, R., Sugino, K., Kvitsiani, D., Fu, Y.,

Lu, J., Lin, Y., et al. (2011). A resource of Cre driver lines for genetic targeting of

GABAergic neurons in cerebral cortex. Neuron

, 995–1013.

4. Harris, J.A., Hirokawa, K.E., Sorensen, S.A., Gu, H., Mills, M., Ng, L.L., Bohn, P.,

Mortrud, M., Ouellette, B., Kidney, J., et al. (2014). Anatomical characterization of

Cre driver mice for neural circuit mapping and manipulation. Front. Neural

Circuits

, 76.

5. Matthaei, K.I. (2007). Genetically manipulated mice: a powerful tool with

unsuspected caveats. J. Physiol.

582

, 481–488.

6. Chen, Y., Molet, J., Gunn, B.G., Ressler, K., and Baram, T.Z. (2015). Diversity of

Reporter Expression Patterns in Transgenic Mouse Lines Targeting Corticotropin-

Releasing Hormone-Expressing Neurons. Endocrinology

156

, 4769–4780.

7. Lammel, S., Steinberg, E.E., Foldy, C., Wall, N.R., Beier, K., Luo, L., and

Malenka, R.C. (2015). Diversity of transgenic mouse models for selective targeting

of midbrain dopamine neurons. Neuron

, 429–438.

8. Gil-Sanz, C., Espinosa, A., Fregoso, S.P., Bluske, K.K., Cunningham, C.L.,

Martinez-Garay, I., Zeng, H., Franco, S.J., and Müller, U. (2015). Lineage Tracing

Using Cux2-Cre and Cux2-CreERT2 Mice. Neuron

, 1091–1099.

9. Wang, W.X., Qiao, J., and Lefebvre, J.L. (2022). PV-IRES-Cre mouse line targets

excitatory granule neurons in the cerebellum. Mol. Brain

, 85.

10. Wissing, C., Maheu, M., Wiegert, J.S., and Dieter, A. (2022). Targeting

noradrenergic neurons of the locus coeruleus: A comparison of model systems and

strategies. bioRxiv, 2022.01.22.477348. 10.1101/2022.01.22.477348.

11. Nigro, M.J., Kirikae, H., Kjelsberg, K., Nair, R.R., and Witter, M.P. (2021). Not All

That Is Gold Glitters: PV-IRES-Cre Mouse Line Shows Low Efficiency of

Labeling of Parvalbumin Interneurons in the Perirhinal Cortex. Front. Neural

Circuits

, 781928.

12. Portales-Casamar, E., Swanson, D.J., Liu, L., de Leeuw, C.N., Banks, K.G., Ho

Sui, S.J., Fulton, D.L., Ali, J., Amirabbasi, M., Arenillas, D.J., et al. (2010). A

regulatory toolbox of MiniPromoters to drive selective expression in the brain.

Proc. Natl. Acad. Sci. U. S. A.

107

, 16589–16594.

13. Fields, R.L., Ponzio, T.A., Kawasaki, M., and Gainer, H. (2012). Cell-type specific

oxytocin gene expression from AAV delivered promoter deletion constructs into

the rat supraoptic nucleus in vivo. PLoS One

, e32085.

Journal Pre-proof

14. Ponzio, T.A., Fields, R.L., Rashid, O.M., Salinas, Y.D., Lubelski, D., and Gainer,

H. (2012). Cell-type specific expression of the vasopressin gene analyzed by AAV

mediated gene delivery of promoter deletion constructs into the rat SON in vivo.

PLoS One

, e48860.

15. De Leeuw, C.N., Korecki, A.J., Berry, G.E., Hickmott, J.W., Lam, S.L., Lengyell,

T.C., Bonaguro, R.J., Borretta, L.J., Chopra, V., Chou, A.Y., et al. (2016). RAAV-

compatible MiniPromoters for restricted expression in the brain and eye. Mol.

Brain

, 52.

16. Hoshino, C., Konno, A., Hosoi, N., Kaneko, R., Mukai, R., Nakai, J., and Hirai, H.

(2021). GABAergic neuron-specific whole-brain transduction by AAV-PHP.B

incorporated with a new GAD65 promoter. Mol. Brain

, 33.

17. Dimidschstein, J., Chen, Q., Tremblay, R., Rogers, S.L., Saldi, G.-A., Guo, L., Xu,

Q., Liu, R., Lu, C., Chu, J., et al. (2016). A viral strategy for targeting and

manipulating interneurons across vertebrate species. Nat. Neurosci.

, 1743–

1749.

18. Vormstein-Schneider, D., Lin, J.D., Pelkey, K.A., Chittajallu, R., Guo, B., Arias-

Garcia, M.A., Allaway, K., Sakopoulos, S., Schneider, G., Stevenson, O., et al.

(2020). Viral manipulation of functionally distinct interneurons in mice, non-

human primates and humans. Nat. Neurosci.

, 1629–1636.

19. Graybuck, L.T., Daigle, T.L., Sedeño-Cortés, A.E., Walker, M., Kalmbach, B.,

Lenz, G.H., Morin, E., Nguyen, T.N., Garren, E., Bendrick, J.L., et al. (2021).

Enhancer viruses for combinatorial cell-subclass-specific labeling. Neuron

109

1449-1464.e13.

20. Mich, J.K., Graybuck, L.T., Hess, E.E., Mahoney, J.T., Kojima, Y., Ding, Y.,

Somasundaram, S., Miller, J.A., Kalmbach, B.E., Radaelli, C., et al. (2021).

Functional enhancer elements drive subclass-selective expression from mouse to

primate neocortex. Cell Rep.

, 108754.

21. Rolland, A.-S., Kareva, T., Kholodilov, N., and Burke, R.E. (2017). A quantitative

evaluation of a 2.5-kb rat tyrosine hydroxylase promoter to target expression in

ventral mesencephalic dopamine neurons in vivo. Neuroscience

346

, 126–134.

22. Nishitani, N., Nagayasu, K., Asaoka, N., Yamashiro, M., Andoh, C., Nagai, Y.,

Kinoshita, H., Kawai, H., Shibui, N., Liu, B., et al. (2019). Manipulation of dorsal

raphe serotonergic neurons modulates active coping to inescapable stress and

anxiety-related behaviors in mice and rats. Neuropsychopharmacology

, 721–

732.

23. Wu, Z., Yang, H., and Colosi, P. (2010). Effect of genome size on AAV vector

packaging. Mol. Ther.

, 80–86.

24. Dong, B., Nakai, H., and Xiao, W. (2010). Characterization of genome integrity for

oversized recombinant AAV vector. Mol. Ther.

, 87–92.

25. Meyer-Lindenberg, A., Domes, G., Kirsch, P., and Heinrichs, M. (2011). Oxytocin

and vasopressin in the human brain: social neuropeptides for translational

medicine. Nat. Rev. Neurosci.

, 524–538.

Journal Pre-proof

26. Dolen, G., Darvishzadeh, A., Huang, K.W., and Malenka, R.C. (2013). Social

reward requires coordinated activity of nucleus accumbens oxytocin and serotonin.

Nature

501

, 179–184.

27. Marlin, B.J., Mitre, M., D’amour, J.A., Chao, M.V., and Froemke, R.C. (2015).

Oxytocin enables maternal behaviour by balancing cortical inhibition. Nature

520

499–504.

28. Inada, K., Hagihara, M., Tsujimoto, K., Abe, T., Konno, A., Hirai, H., Kiyonari, H.,

and Miyamichi, K. (2022). Plasticity of neural connections underlying oxytocin-

mediated parental behaviors of male mice. Neuron

110

, 2009-2023.e5.

29. Peñagarikano, O., Lázaro, M.T., Lu, X.-H., Gordon, A., Dong, H., Lam, H.A.,

Peles, E., Maidment, N.T., Murphy, N.P., Yang, X.W., et al. (2015). Exogenous and

evoked oxytocin restores social behavior in the Cntnap2 mouse model of autism.

Sci. Transl. Med.

, 271ra8.

30. Kitagawa, K., Matsumura, K., Baba, M., Kondo, M., Takemoto, T., Nagayasu, K.,

Ago, Y., Seiriki, K., Hayata-Takano, A., Kasai, A., et al. (2021). Intranasal oxytocin

administration ameliorates social behavioral deficits in a POGZWT/Q1038R

mouse model of autism spectrum disorder. Mol. Brain

, 56.

31. Takemoto, T., Baba, M., Yokoyama, K., Kitagawa, K., Nagayasu, K., Ago, Y.,

Seiriki, K., Hayata-Takano, A., Kasai, A., Mori, D., et al. (2022). Oxytocin

ameliorates impaired social behavior in a mouse model of 3q29 deletion syndrome.

Mol. Brain

, 26.

32. Knobloch, H.S., Charlet, A., Hoffmann, L.C., Eliava, M., Khrulev, S., Cetin, A.H.,

Osten, P., Schwarz, M.K., Seeburg, P.H., Stoop, R., et al. (2012). Evoked axonal

oxytocin release in the central amygdala attenuates fear response. Neuron

, 553–

566.

33. Eliava, M., Melchior, M., Knobloch-Bollmann, H.S., Wahis, J., da Silva Gouveia,

M., Tang, Y., Ciobanu, A.C., Triana Del Rio, R., Roth, L.C., Althammer, F., et al.

(2016). A New Population of Parvocellular Oxytocin Neurons Controlling

Magnocellular Neuron Activity and Inflammatory Pain Processing. Neuron

1291–1304.

34. Oettl, L.L., Ravi, N., Schneider, M., Scheller, M.F., Schneider, P., Mitre, M., da

Silva Gouveia, M., Froemke, R.C., Chao, M.V., Young, W.S., et al. (2016).

Oxytocin Enhances Social Recognition by Modulating Cortical Control of Early

Olfactory Processing. Neuron

, 609–621.

35. Zheng, J.-J., Li, S.-J., Zhang, X.-D., Miao, W.-Y., Zhang, D., Yao, H., and Yu, X.

(2014). Oxytocin mediates early experience-dependent cross-modal plasticity in

the sensory cortices. Nat. Neurosci.

, 391–399.

36. Thirtamara Rajamani, K., Leithead, A.B., Kim, M., Barbier, M., Peruggia, M.,

Niblo, K., Barteczko, L., Lefevre, A., Grinevich, V., and Harony-Nicolas, H.

(2021). Efficiency of cell-type specific and generic promoters in transducing

oxytocin neurons and monitoring their neural activity during lactation. Sci. Rep.

, 22541.

Journal Pre-proof

37. Haberman, R.P., McCown, T.J., and Samulski, R.J. (2000). Novel Transcriptional

Regulatory Signals in the Adeno-Associated Virus Terminal Repeat A/D Junction

Element. J. Virol.

, 8732–8739.

38. Nair, R.R., Blankvoort, S., Lagartos, M.J., and Kentros, C. (2020). Enhancer-

Driven Gene Expression (EDGE) Enables the Generation of Viral Vectors Specific

to Neuronal Subtypes. iScience

, 100888.

39. Zufferey, R., Donello, J.E., Trono, D., and Hope, T.J. (1999). Woodchuck hepatitis

virus posttranscriptional regulatory element enhances expression of transgenes

delivered by retroviral vectors. J. Virol.

, 2886–2892.

40. Shaner, N.C., Lambert, G.G., Chammas, A., Ni, Y., Cranfill, P.J., Baird, M.A., Sell,

B.R., Allen, J.R., Day, R.N., Israelsson, M., et al. (2013). A bright monomeric

green fluorescent protein derived from Branchiostoma lanceolatum. Nat. Methods

, 407–409.

41. Dierickx, K., and Vandesande, F. (1979). Immunocytochemical demonstration of

separate vasopressin-neurophysin and oxytocin-neurophysin neurons in the human

hypothalamus. Cell Tissue Res.

196

, 203–212.

42. Hörnberg, H., Pérez-Garci, E., Schreiner, D., Hatstatt-Burklé, L., Magara, F.,

Baudouin, S., Matter, A., Nacro, K., Pecho-Vrieseling, E., and Scheiffele, P.

(2020). Rescue of oxytocin response and social behaviour in a mouse model of

autism. Nature

584

, 252–256.

43. Liu, B., Wang, S., Brenner, M., Paton, J.F.R., and Kasparov, S. (2008).

Enhancement of cell-specific transgene expression from a Tet-Off regulatory

system using a transcriptional amplification strategy in the rat brain. J. Gene Med.

, 583–592.

44. Sohn, J., Takahashi, M., Okamoto, S., Ishida, Y., Furuta, T., and Hioki, H. (2017).

A Single Vector Platform for High-Level Gene Transduction of Central Neurons:

Adeno-Associated Virus Vector Equipped with the Tet-Off System. PLoS One

e0169611.

45. Sakaguchi, R., Leiwe, M.N., and Imai, T. (2018). Bright multicolor labeling of

neuronal circuits with fluorescent proteins and chemical tags. Elife

, 1–28.

46. Yaguchi, K., Hagihara, M., Konno, A., Hirai, H., Yukinaga, H., and Miyamichi, K.

(2023). Dynamic modulation of pulsatile activities of oxytocin neurons in lactating

wild-type mice. PLoS One

, e0285589.

47. Atasoy, D., Aponte, Y., Su, H.H., and Sternson, S.M. (2008). A FLEX switch

targets Channelrhodopsin-2 to multiple cell types for imaging and long-range

circuit mapping. J. Neurosci.

, 7025–7030.

48. Shimshek, D.R., Kim, J., Hübner, M.R., Spergel, D.J., Buchholz, F., Casanova, E.,

Stewart, A.F., Seeburg, P.H., and Sprengel, R. (2002). Codon-improved Cre

recombinase (iCre) expression in the mouse. Genesis

, 19–26.

49. Eguchi, M., and Yamaguchi, S. (2009). In vivo and in vitro visualization of gene

expression dynamics over extensive areas of the brain. Neuroimage

, 1274–

1283.

Journal Pre-proof

50. Son, S., Manjila, S.B., Newmaster, K.T., Wu, Y.-T., Vanselow, D.J., Ciarletta, M.,

Anthony, T.E., Cheng, K.C., and Kim, Y. (2022). Whole-Brain Wiring Diagram of

Oxytocin System in Adult Mice. J. Neurosci.

, 5021–5033.

51. Freda, S.N., Priest, M.F., Badong, D., Xiao, L., Liu, Y., and Kozorovitskiy, Y.

(2022). Brainwide input-output architecture of paraventricular oxytocin and

vasopressin neurons. bioRxiv, 2022.01.17.476652. 10.1101/2022.01.17.476652.

52. Bindels, D.S., Haarbosch, L., van Weeren, L., Postma, M., Wiese, K.E., Mastop,

M., Aumonier, S., Gotthard, G., Royant, A., Hink, M.A., et al. (2017). mScarlet: a

bright monomeric red fluorescent protein for cellular imaging. Nat. Methods

53–56.

53. Furuta, T., Tomioka, R., Taki, K., Nakamura, K., Tamamaki, N., and Kaneko, T.

(2001). In vivo transduction of central neurons using recombinant Sindbis virus:

Golgi-like labeling of dendrites and axons with membrane-targeted fluorescent

proteins. J. Histochem. Cytochem.

, 1497–1508.

54. Hioki, H., Kuramoto, E., Konno, M., Kameda, H., Takahashi, Y., Nakano, T.,

Nakamura, K.C., and Kaneko, T. (2009). High-level transgene expression in

neurons by lentivirus with Tet-Off system. Neurosci. Res.

, 149–154.

55. Seiriki, K., Kasai, A., Hashimoto, T., Schulze, W., Niu, M., Yamaguchi, S.,

Nakazawa, T., Inoue, K.-I., Uezono, S., Takada, M., et al. (2017). High-Speed and

Scalable Whole-Brain Imaging in Rodents and Primates. Neuron

, 1085-1100.e6.

56. Seiriki, K., Kasai, A., Nakazawa, T., Niu, M., Naka, Y., Tanuma, M., Igarashi, H.,

Yamaura, K., Hayata-Takano, A., Ago, Y., et al. (2019). Whole-brain block-face

serial microscopy tomography at subcellular resolution using FAST. Nat. Protoc.

10.1038/s41596-019-0148-4.

57. Chan, K.Y., Jang, M.J., Yoo, B.B., Greenbaum, A., Ravi, N., Wu, W.L., Sánchez-

Guardado, L., Lois, C., Mazmanian, S.K., Deverman, B.E., et al. (2017).

Engineered AAVs for efficient noninvasive gene delivery to the central and

peripheral nervous systems. Nat. Neurosci.

, 1172–1179.

58. Nagai, Y., Takayama, K., Nishitani, N., Andoh, C., Koda, M., Shirakawa, H.,

Nakagawa, T., Nagayasu, K., Yamanaka, A., and Kaneko, S. (2020). The Role of

Dorsal Raphe Serotonin Neurons in the Balance between Reward and Aversion.

Int. J. Mol. Sci.

. 10.3390/ijms21062160.

59. Nagai, Y., Kisaka, Y., Nomura, K., Nishitani, N., Andoh, C., Koda, M., Kawai, H.,

Seiriki, K., Nagayasu, K., Kasai, A., et al. (2023). Dorsal raphe serotonergic

neurons preferentially reactivate dorsal dentate gyrus cell ensembles associated

with positive experience. Cell Rep.

, 112149.

60. Ran, F.A., Cong, L., Yan, W.X., Scott, D.A., Gootenberg, J.S., Kriz, A.J., Zetsche,

B., Shalem, O., Wu, X., Makarova, K.S., et al. (2015). In vivo genome editing

using Staphylococcus aureus Cas9. Nature

520

, 186–191.

61. Hunker, A.C., Soden, M.E., Krayushkina, D., Heymann, G., Awatramani, R., and

Zweifel, L.S. (2020). Conditional single vector CRISPR/SaCas9 viruses for

efficient Mutagenesis in the adult mouse nervous system. Cell Rep.

, 4303-

4316.e6.

Journal Pre-proof

62. Gusel’nikova, V.V., and Korzhevskiy, D.E. (2015). NeuN As a Neuronal Nuclear

Antigen and Neuron Differentiation Marker. Acta Naturae

, 42–47.

63. Zeng, H., and Madisen, L. (2012). Mouse transgenic approaches in optogenetics.

Prog. Brain Res.

196

, 193–213.

64. Sun, H., Fu, S., Cui, S., Yin, X., Sun, X., Qi, X., Cui, K., Wang, J., Ma, L., Liu, F.-

Y., et al. (2020). Development of a CRISPR-SaCas9 system for projection- and

function-specific gene editing in the rat brain. Sci Adv

, eaay6687.

65. Stevens, L., Vonck, K., Larsen, L.E., Van Lysebettens, W., Germonpré, C.,

Baekelandt, V., Van den Haute, C., Carrette, E., Wadman, W.J., Boon, P., et al.

(2020). A Feasibility Study to Investigate Chemogenetic Modulation of the Locus

Coeruleus by Means of Single Unit Activity. Front. Neurosci.

, 1–9.

66. Swanson, L.W., and Sawchenko, P.E. (1983). Hypothalamic integration:

organization of the paraventricular and supraoptic nuclei. Annu. Rev. Neurosci.

269–324.

67. Ludwig, M. (1998). Dendritic release of vasopressin and oxytocin. J.

Neuroendocrinol.

, 881–895.

68. Gimpl, G., and Fahrenholz, F. (2001). The oxytocin receptor system: structure,

function, and regulation. Physiol. Rev.

, 629–683.

69. Tervo, D.G.R., Hwang, B.Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K.D.,

Lindo, S., Michael, S., Kuleshova, E., Ojala, D., et al. (2016). A Designer AAV

Variant Permits Efficient Retrograde Access to Projection Neurons. Neuron

372–382.

70. Challis, R.C., Ravindra Kumar, S., Chan, K.Y., Challis, C., Beadle, K., Jang, M.J.,

Kim, H.M., Rajendran, P.S., Tompkins, J.D., Shivkumar, K., et al. (2019). Systemic

AAV vectors for widespread and targeted gene delivery in rodents. Nat. Protoc.

379–414.

71. Loew, R., Heinz, N., Hampf, M., Bujard, H., and Gossen, M. (2010). Improved

Tet-responsive promoters with minimized background expression. BMC

Biotechnol.

, 81.

72. Stergachis, A.B., Haugen, E., Shafer, A., Fu, W., Vernot, B., Reynolds, A.,

Raubitschek, A., Ziegler, S., LeProust, E.M., Akey, J.M., et al. (2013). Exonic

transcription factor binding directs codon choice and affects protein evolution.

Science

342

, 1367–1372.

73. Davis, M.W., and Jorgensen, E.M. (2022). ApE, A Plasmid Editor: A Freely

Available DNA Manipulation and Visualization Program. Front Bioinform

818619.

74. Lin, R., Wang, R., Yuan, J., Feng, Q., Zhou, Y., Zeng, S., Ren, M., Jiang, S., Ni, H.,

Zhou, C., et al. (2018). Cell-type-specific and projection-specific brain-wide

reconstruction of single neurons. Nat. Methods

, 1033–1036.

75. Niu, M., Kasai, A., Tanuma, M., Seiriki, K., Igarashi, H., Kuwaki, T., Nagayasu,

K., Miyaji, K., Ueno, H., Tanabe, W., et al. (2022). Claustrum mediates

Journal Pre-proof

polyA

mOXTp-1.0 kb

ITR

mNeonGreen

WPRE

Viral constructs

polyA

mOXTp-1.0 kb

ITR

mNeonGreen

TAREGET-

OXT

polyA

ITR

tTA

WPRE

polyA

TRE

ITR

mNeonGreen

ITR

mOXTp-1.0 kb

mNG(+)

∩

anti-NP1(+)

(%)

mNG(+)

∩

anti-NP1(+)

mNG(+)

(%)

Labeling efficiency in the targeted cell type

AAV9 Injection

109 vg per injection site

Perfusion

14 days

Sectioning

and

IHC

2–7 days

10–20 serial slices (25 μm)

Anti-NP1 or AVP

Figure 1. Optimization of the expression control system and regulatory component in recombinant

AAV genomes using OXT promoter.

C57B6 mice (wild-type)

PVH

mNeonGreen

Anti-NP1

Overlay

polyA

ITR

tTA

WPRE

polyA

TRE

ITR

mNeonGreen

ITR

mOXTp-1.0 kb

polyA

ITR

tTA

WPRE

polyA

TRE

ITR

mNeonGreen

ITR

WPRE

mOXTp-1.0 kb

polyA

mOXTp-1.0 kb

ITR

tTA

polyA

ITR

WPRE

TRE

mNeonGreen

polyA

ITR

polyA

ITR

TRE

mNeonGreen

mOXTp-1.0 kb

tTA

polyA

ITR

mOXTp-1.0 kb

mNeonGreen

100

Not detected

Cell-type specificity

Not detected

Journal Pre-proof

Figure 2. AAV TAREGET allows specific gene expression in OXT neurons but requires optimization

of promoter activity.

WPRE

polyA

TRE

ITR

mNeonGreen

ITR

polyA

ITR

tTA

mOXTp 1.0 kb

polyA

ITR

tTA

mOXTp 2.6 kb

Anti-NP1

mNeonGreen

Overlay

Anti-AVP

mNeonGreen

Overlay

)

∩

-A

)

∩

-N

)

****

1.0 kb

2.6 kb

100

***

1.0 kb

2.6 kb

tTA driver AAVs

Reporter AAV

Journal Pre-proof

Figure 3. TAREGET strategy has greater suitability for the Tet-Off system compared to the Cre-lox

expression system in OXT neurons.

WPRE

polyA

ITR

EF1α p

ITR

polyA

ITR

mOXTp 1.0 kb

iCre

polyA

ITR

mOXTp 1.0 kb

Destabilized iCre

(diCre)

Anti-NP1

mNeonGreen

Overlay

Anti-AVP

mNeonGreen

Overlay

)

∩

-A

)

∩

-N

)

****

***

iCre diCre tTA

100

***

n.s.

iCre diCre tTA

Cre driver AAVs

Reporter AAV

Journal Pre-proof

Figure 4. AAV TAREGET-OXT allows robust reporter gene expression to visualize axonal fibers

throughout the whole brain in wild-type mice.

pal-mScarlet

Anti-NP1

Overlay

200 µm

100

Days after viral injection

tTA driver AAV

Reporter AAV

WPRE

polyA

TRE

ITR

pal-mScarlet

ITR

polyA

ITR

tTA

mOXTp 1.0 kb

C57BL/6 mice (wild-type)

PVH

AAV9 Injection

109 vg per injection site

Perfusion

14 or 21 days

Imaging by FAST

2–7 days

Post-hoc

IHC

200–250 slices (50 μm)

Anti-NP1

Overnight

VTA, SN

PVT

ACB

NTS, DMX

LC, PBN

DRN, PAG

PVH

3D-Rendering

)

∩

-N

)

∩

-N

)

-N

)

Journal Pre-proof

Figure 5. Application of the TAREGET strategy for labeling other cell types.

tTA driver : reporter

VTA

IW-TH-mNG

TH-mNG-W

TAREGET-TH

ITR

WPRE

polyA

TRE

ITR

mNeonGreen

ITR

polyA

ITR

tTA

mTHp-2.6 kb

mNG(+)

∩

anti-TH(+)

(%)

mNG(+)

∩

anti-TH(+)

mNG(+)

(%)

Anti-TH

mNeonGreen

Overlay

-m

-W

-m

-W

-m

-W

-T

-m

-T

-m

-T

-m

polyA

ITR

mNeonGreen

WPRE

mTHp-2.6 kb

polyA

ITR

mNeonGreen

mTHp-2.6 kb

Viral constructs

Injected titer

C57BL/6 mice

vg or 10

vg : 10

100

Cell-type specificity

Labeling efficiency in the targeted cell type

Not detected

Journal Pre-proof

100

120

****

Figure 6. Application of the TAREGET system for cell-type-specific CRISPR-mediated gene

knockdown.

VTA

TAREGET-TH tTA only

CMV-saCa9-U6-sgNeuN (sgRbfox3)

TAREGET-TH::saCas9-U6-sgNeuN (sgRbfox3)

ITR

polyA

ITR

tTA

mTHp-2.6 kb

ITR

polyA

ITR

tTA

mTHp-2.6 kb

polyA

TRE

CMV

sgRNA

ITR

saCas9-HA×3

ITR

Viral constructs

Injected titer

C57BL/6 mice

5 × 10

:5 × 10

CGCCTCAGAATGGAATCCCAG

PAM

(

Guide sequence

in mouse

Rbfox3

exon 5

Anti-TH

Anti-HA

Anti-NeuN

Overlay

-s

-T

100

****

-s

as9

T-

::s

-s

as9

T-

::s

100

n.s.

-s

as9

T-

::s

)

∩

)

∩

)

-i

)

(

)

NeuN konckdown

Cell-type specificity

Labeling efficiency

VTA

SNC

Journal Pre-proof

KEY RESOURCES TABLE

Key resources table

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Antibodies

Anti-Neurophysin 1 Antibody, clone PS 38

Merck

Cat# MABN844

Recombinant Anti-Vasopressin antibody

Abcam

Cat# ab213708

Rabbit Cleaved Caspase-3 (Asp175) Antibody

Cell Signaling
Technology

Cat# 9661S
RRID:AB_2341188

Rabbit Anti-Tryptophan Hydroxylase 2 Antibody

Novus Biologicals

Cat# NB100-74555,
RRID:AB_1049988

Chicken Anti-Tyrosine Hydroxylase Antibody

Abcam

Cat# ab76442,
RRID:AB_1524535

Mouse Anti-HA-tag mAb

MBL

Cat# M180-3
RRID:AB_10951811

Rabbit Anti-NeuN antibody

Abcam

Cat# ab177487
RRID:AB_2532109

Goat Anti-Mouse IgG H&L (Alexa Fluor® 488)

Abcam

Cat# ab150113,
RRID:AB_2576208

Goat Anti-Mouse IgG H&L (Alexa Fluor® 568)

Abcam

Cat# ab175473,
RRID:AB 2895153

Goat Anti-Rabbit IgG H&L (Alexa Fluor® 568)

Abcam

Cat# ab175471,
RRID:AB 2576207

Goat Anti-Chicken IgY H&L (Alexa Fluor® 568)

Abcam

Cat# ab175477
RRID:AB_3076392

Goat Anti-Mouse IgG H&L (Alexa Fluor® 647)

Abcam

Cat# ab150115
RRID:AB_2687948

Goat Anti-Chicken IgY H&L (Alexa Fluor® 647)

Abcam

Cat# ab150171
RRID:AB_2921318

Bacterial and virus strains

DH5α competent cells

Takara Bio Inc.

Cat# 9057

AAV9-mOXTp-1.0 kb-tTA-WPRE-pA

This paper

N/A

AAV9-mOXTp-1.0 kb-tTA-pA

This paper

N/A

AAV9-IW-mOXTp-1.0 kb-tTA-pA (TAREGET-OXT)

This paper

N/A

AAV9-mOXTp-1.0 kb-mNG-WPRE-pA

This paper

N/A

AAV9-mOXTp-1.0 kb-mNG-pA

This paper

N/A

AAV9-IW-mOXTp-1.0 kb-mNG-pA

This paper

N/A

AAV9-mTHp-2.6 kb-mNG-WPRE-pA

This paper

N/A

AAV9-IW-mTHp-2.6 kb-mNG-pA

This paper

N/A

AAV9-IW-mTHp-2.6 kb-tTA (TAREGET-TH)

This paper

N/A

AAV9-mTPH2p-2.0 kb-mNG-WPRE-pA

This paper

N/A

AAV9-IW-mTPH2p-2.0 kb-mNG-pA

This paper

N/A

AAV9-IW-mTPH2p-2.0 kb-tTA (TAREGET-TPH2)

This paper

N/A

AAV9-TRE-mNG-WPRE-pA

This paper

N/A

AAV9-TRE-mNG-pA

This paper

N/A

AAV9-IW-mOXTp-2.6 kb-tTA-pA

This paper

N/A

Journal Pre-proof

AAV9-IW-mOXTp-1.0 kb-iCre-pA

This paper

N/A

AAV9-IW-mOXTp-1.0 kb-diCre-pA

This paper

N/A

AAV9-

EF1α

-DIO-mNG-WPRE-pA

This paper

N/A

AAV9-TRE-pal-mScarlet-WPRE-pA

Hirato et al., 2024

N/A

AAV9-CMV-saCas9-pA-U6-sgNeuN(Rbfox3)

This paper

N/A

AAV9-TRE-saCas9-pA-U6-sgNeuN(Rbfox3)

This paper

N/A

Biological samples

Chemicals, peptides, and recombinant proteins

In-Fusion HD Cloning Kit

Takara

Cat# 639650

DNA Ligation Kit

Takara

Cat# 6023

Phusion High-Fidelity DNA polymerase

Thermo Fisher

F530L

PEI MAX

Polyscience Inc.

Cat# 24765

DMEM, high glucose, GlutaMAX™ Supplement

Thermo Fisher

Cat # 10566024

Benzonase® Nuclease

Millipore

Cat# E1014-25KU

Critical commercial assays

GoTaq® qPCR Master Mix

Promega

Cat# A6001/2

Deposited data

Experimental models: Cell lines

Lenti-

X™ 293T cell

line

Clontech

Cat# 632180

Experimental models: Organisms/strains

C57BL/6NCrSlc

Japan SLC,Inc.

MGI: 5295404

C57BL/6JJmsSlc

Japan SLC,Inc.

MGI: 5488963

Oligonucleotides

Recombinant DNA

pAAV-mOXTp-1.0 kb-tTA-WPRE-pA

This paper

N/A

pAAV-mOXTp-1.0 kb-tTA-pA

This paper

N/A

pAAV-IW-mOXTp-1.0 kb-tTA-pA (TAREGET-OXT)

This paper

N/A

Journal Pre-proof

pAAV-mOXTp-1.0 kb-mNG-WPRE-pA

This paper

N/A

pAAV-mOXTp-1.0 kb-mNG-pA

This paper

N/A

pAAV-IWmOXTp-1.0 kb-mNG-pA

This paper

N/A

pAAV-mTHp-2.6 kb-mNG-WPRE-pA

This paper

N/A

pAAV-IW-mTHp-2.6 kb-mNG-pA

This paper

N/A

pAAV-IW-mTHp-2.6 kb-tTA (TAREGET-TH)

This paper

N/A

pAAV-mTPH2p-2.0 kb-mNG-WPRE-pA

This paper

N/A

pAAV-IW-mTPH2p-2.0 kb-mNG-pA

This paper

N/A

pAAV-IW-mTPH2p-2.0 kb-tTA (TAREGET-TPH2)

This paper

N/A

pAAV-TRE-mNG-WPRE-pA

Chan KY et al., 2017

Addgene, #99131
RRID:
Addgene_99131

pAAV-TRE-mNG-pA

This paper

N/A

pAAV-IW-mOXTp-2.6 kb-tTA-pA

This paper

N/A

pAAV-IW-mOXTp-1.0 kb-iCre-pA

This paper

N/A

pAAV-IW-mOXTp-1.0 kb-diCre-pA

This paper

N/A

pAAV-

EF1α

-DIO-mNG-WPRE-pA

This paper

N/A

pAAV-TRE-pal-mScarlet-WPRE-pA

Hirato et al., 2024

N/A

pAAV-CMV-saCas9-pA-U6-BsaI-sgRNA

https://www.addgene
.org/61591/

Addgene, #61591
RRID:Addgene_6159
1

pAAV-CMV-saCas9-pA-U6-sgNeuN(Rbfox3)

This paper

N/A

pAAV-TRE-saCas9-pA-U6-sgNeuN(Rbfox3)

This paper

N/A

pAAV-mOXT-hM3Dq-mCherry

Peñagarikano O et al.,
2015

Addgene, #70717
RRID:
Addgene_70717

pAAV-TRE-DIO-FlpO

Lin R et al., 2018

Addgene, #118027
RRID:
Addgene_118027

pAAV-EF1-DIO-hM3Dq-mCherry

https://www.addgene
.org/50460/

Addgene, #50460
RRID:
Addgene_50460

pAAV-CAG-fDIO-mNeonGreen

Chan KY et al. 2017

Addgene, # 99133
RRID:
Addgene_99133

pAAV-CaMKIIa-mScarlet

Marshel JH et al., 2019 Addgene, #131000

RRID:
Addgene_131000

pHelper-AAV

Cell Biolabs

Part# 340202 in Cat#
VPK-400-DJ

pAAV2/9n

https://www.addgene
.org/112865/

Addgene, #112865
RRID:
Addgene_112865

Software and algorithms

Fiji for Windows

Schindelin et al., 2012

RRID: SCR_002285

https://fiji.sc/

Journal Pre-proof