2024.01.12.575269v1.full-html.html

bioRxiv preprint

Abstract

(246/250 words, including citations)

Reelin, a secreted glycoprotein, plays a crucial role in guiding neocortical neuronal migration, dendritic

outgrowth and arborization, and synaptic plasticity in the adult brain. Reelin primarily operates through the

canonical lipoprotein receptors apolipoprotein E receptor 2 (Apoer2) and very low-density lipoprotein

receptor (Vldlr). Reelin also engages with non-canonical receptors and unidentified co-receptors; however,

the effects of which are less understood. Using high-throughput tandem mass tag LC-MS/MS-based

proteomics and gene set enrichment analysis, we identified both shared and unique intracellular pathways

activated by Reelin through its canonical and non-canonical signaling in primary murine neurons during

dendritic growth and arborization. We observed pathway crosstalk related to regulation of cytoskeleton,

neuron projection development, protein transport, and actin filament-based process. We also found enriched

gene sets exclusively by the non-canonical Reelin pathway including protein translation, mRNA metabolic

process and ribonucleoprotein complex biogenesis suggesting Reelin fine-tunes neuronal structure through

distinct signaling pathways. A key discovery is the identification of aldolase A, a glycolytic enzyme and

actin binding protein, as a novel effector of Reelin signaling. Reelin induced

de novo

translation and

mobilization of aldolase A from the actin cytoskeleton. We demonstrated that aldolase A is necessary for

Reelin-mediated dendrite growth and arborization in primary murine neurons and mouse brain cortical

neurons

Interestingly, the function of aldolase A in dendrite development is

independent of its known role

in glycolysis. Altogether, our findings provide new insights into the Reelin-dependent signaling pathways

and effector proteins that are crucial for actin remodeling and dendritic development.

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Introduction

(544/650 words)

Reelin is a secreted glycoprotein important for mammalian brain development and synaptic function (Tissir

and Goffinet, 2003; Jossin, 2020). The canonical Reelin signaling pathway through the apolipoprotein E

receptor 2 (Apoer2) and very low-density lipoprotein receptor (Vldlr) is best known for its role in neuronal

migration and positioning in cortical layering during prenatal brain development (Caviness, 1976; Pinto-

Lord et al., 1982; D'Arcangelo et al., 1995; Curran and D'Arcangelo, 1998; Trommsdorff et al., 1999) .

Upon Reelin binding, Apoer2/Vldlr receptor clustering triggers intracellular Dab1 phosphorylation by

the

Src-family tyrosine kinases (SFK) which leads to the activation of multiple downstream signaling pathways

including phosphatidylinositol-3-kinase (PI3K) signaling to promote cytoskeletal changes necessary for

correct neuronal positioning, axon guidance, dendrite growth and branching (Pinto Lord and Caviness,

1979; Rice et al., 1998; Hiesberger et al., 1999; Howell et al., 1999; Howell et al., 2000; Arnaud et al.,

2003; Bock and Herz, 2003; Niu et al., 2004; Jossin and Goffinet, 2007; Matsuki et al., 2008; Leemhuis et

al., 2010; Dillon et al., 2017). In the adult brain, Reelin signaling also promotes the maturation and

stabilization of dendritic spines (Pappas et al., 2001; Niu et al., 2008; Rogers et al., 2011; Bosch et al.,

2016), the primary sites of excitatory synaptic transmission and activity-dependent synaptic plasticity,

where Reelin has been shown to enhance hippocampal LTP and modulate synaptic remodeling (Weeber et

al., 2002; Beffert et al., 2005; Chen et al., 2005; Rogers et al., 2011; Bal et al., 2013). Therefore, a loss of

Reelin or disruption in the Reelin signaling pathway has been implicated in a wide range of human

neurological disorders such as lissencephaly, ataxia, autism spectrum disorders, schizophrenia, bipolar

disorder, epilepsy, and Alzheimer’s disease (Impagnatiello et al., 1998; Guidotti et al., 2000; Hong et al.,

2000; Perisco et al., 2001; Grayson et al., 2005).

Reelin also signals through a non-canonical pathway outside of Apoer2/Vldlr; such as integrins and

ephrin receptors which act to further fine-tune Reelin-dependent migration (Dulabon et al., 2000; Bouche

et al., 2013; Lee et al., 2014; Kohno et al., 2020). As such, Reelin signaling is multifaceted and activates

overlapping signaling pathways following Reelin binding to its cell surface receptors. However, most of

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

these pathways are not well characterized. Here, we investigated the role of the PI3K pathway in Reelin

signaling on cytoskeleton remodeling related to dendritic outgrowth and branching. We conducted an

unbiased tandem mass tag (TMT) LC-MS/MS proteomics screen to delineate canonical and non-canonical

Reelin signaling and identified overlapping and distinct intracellular pathways in primary murine neurons

during periods of robust neurite outgrowth. We observed pathway crosstalk between the canonical and non-

canonical Reelin signaling pathways related to regulation of cytoskeleton, neuron projection development,

protein transport, and actin filament-based process. We demonstrate that Reelin signaling regulates actin

dynamics in developing neurites and found aldolase A, a glycolytic enzyme and actin-binding protein, as a

novel downstream effector in the Reelin pathway that contributes to actin remodeling changes necessary

for dendritic growth and arborization. Interestingly, the function of aldolase A on dendrite outgrowth is

independent of its glycolytic function. These findings uncover novel aspects of Reelin signaling revealing

broader impact beyond the well-known canonical pathways and the discovery of aldolase A as a novel

Reelin effector in influencing actin remodeling and cytoskeletal dynamics on neuronal structure and

growth.

Materials and Methods

Mice.

All animal use was approved by the Institutional Animal Care and Use Committee at Boston

University and methods were performed in accordance with relevant guidelines and regulations. Timed

pregnant Crl:CD1 (ICR) dams (strain code: 022, RRID:IMSR_CRL:022) were purchased from Charles

River Laboratories. Mice of either sex were used for all mouse studies.

Primary murine neuronal cultures.

Primary cortical and hippocampal neurons were prepared from CD1

embryos of either sex at embryonic (E) 16.5 and E18.5, respectively. Briefly, the cortex and the hippocampi

were independently dissected from each individual embryo, and dissociated with trypsin for 10 min at 37

triturated, and plated onto pre-treated 100 mg/mL Poly-L-lysine wells (Sigma-Aldrich Cat# P2636-100MG)

24 h prior to plating. To ensure consistency between cultures, cell density of the single cell suspension was

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

determined using Trypan blue and a hemocytometer. Cortical neurons were plated at 7.5x10

cells/well (12

well plate) and hippocampal neurons were plated at 5x10

cells/well (24-well plate). Neurons were

maintained in neurobasal media (Thermo Fisher Scientific Cat# 21103049) supplemented with 2% (v/v)

B27 (Thermo Fisher Scientific Cat# 17504044) and 0.5 mM glutamine (Thermo Fisher Scientific Cat#

25030081) in a humidified incubator with 5% CO

at 37

Generation of recombinant Reelin and GST-RAP.

Stably transfected HEK293 cells (ATCC Cat# CRL-

1573, RRID:CVCL_0045) expressing full-length murine Reelin were grown in T75 flasks in DMEM media

and maintained at 37°C and 5% CO2. At ~70% confluency, the media was replaced with phenol red free

neurobasal media. Following 48 h, the media was collected and spun down at 500 x

at 4°C for 5 min to

pellet cellular debris and dead cells. The supernatant was collected and concentrated using an Amicon

stirred ultrafiltration cell (Millipore Cat# 5124) with a Biomax 100 kDa ultrafiltration molecular weight

membrane (Millipore Cat# PBHK06210). The concentrated Reelin containing media was sterile filtered

using a 0.45µm syringe filter (Millipore Cat# SLHAM33SS), aliquoted, and stored at -80°C. Mock media

was generated using control vector transfected HEK293 cells and collected in parallel to the Reelin

conditioned media to ensure consistency between conditions. Reelin- and mock-conditioned supernatants

were tested for their ability to stimulate Reelin-dependent phosphorylation of Dab1. pGEX-RAP was

transformed into BL21 DE3

E. coli.

A single, isolated, colony was inoculated in a 5 mL starter culture and

subsequently grown into 300 mL of LB media and induced with 1 mM IPTG for 4 h at 37

C. Cultures were

spun down at 10,000 x

for 15 min at 4

C and the pellet was snap frozen in liquid nitrogen and kept at -

C for 15 min. Pellet was thawed and resuspended in 20 mL ice cold PBS-L (3U Benzonase/mL culture,

1% Triton X-100, 1 mM 2-Mercaptoethanol, 1 mM EDTA, 1 mg/mL Lysozyme, 2ug/mL Aprotinin,

1ug/mL Pepstatin, 1ug/mL Leupeptin in PBS). Resuspension was incubated at room temperature for 30

min on nutator and centrifuged at 4000 x

for 30 min at 4

C. Supernatant was run through a glutathione

affinity resin column under gravity flow and GST-RAP was eluted with glutathione buffer (50 mM reduced

glutathione, 50 mM Tris HCL pH 8.0 in PBS) and sterile filtered.

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Biochemical analysis and quantitative immunoblotting.

For Reelin stimulation, primary murine cortical

neurons were treated with 50 nM of Reelin or mock control media at 3, 7, or 14 days

in vitro

(DIV) for 30

min. GST-RAP conditions were pre-treated with 100 nM GST-RAP or GST 2 h prior to Reelin treatment.

For Dab1 immunoprecipitation, neurons were lysed in immunoprecipitation buffer containing: 10 mM Tris

HCL pH 8.0, 1% Triton X-100, 150 mM NaCl, 1 mM EDTA pH 8.0, 2 g/mL Aprotinin, 1 g/mL

Pepstatin, 1 g/mL Leupeptin, and Phosphatase inhibitor cocktail (Bimake Cat# B15001). Cell lysates were

incubated with precipitating antibody against Dab1 (mouse anti-Dab1 #2721, 1:100, kindly provided by

Dr. Joachim Herz) for 2 h at 4

C followed by overnight incubation with 20 L of protein G Ultralink resin

(ThermoFisher Cat# 53128). The resins were washed with immunoprecipitation buffer and precipitated

proteins were eluted with reducing SDS sample buffer, boiling for 5 min and resolved by SDS-PAGE. For

pathway inhibitor treatments, neurons were treated either with 50 m LY294002 (Cell Signaling

Technology Cat# 9901S), 200 nM Rapamycin (Millipore Cat# 553211), or DMSO vehicle control for 30

min prior to Reelin stimulation. Briefly, cells were rinsed with PBS and collected in RIPA buffer (150 mM

NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCL pH 8.0) supplemented with

protease and phosphatase inhibitors. For Western blotting, nitrocellulose membranes were blocked in 1:1

solution of PBS and LI-COR blocking buffer for 1 h at room temperature and incubated in primary

antibodies overnight at 4

C. Primary antibodies used were mouse anti-Akt (Cell Signaling Technology Cat#

2920S, 1:2000, RRID:AB_1147620), rabbit anti-Phospho-Akt Ser473 (Cell Signaling Technology Cat#

4060S, 1:2000, RRID:AB_2315049), mouse anti-p70 S6 kinase alpha (Santa Cruz Biotechnology Cat# sc-

8418, 1:500, RRID:AB_628094), rabbit anti-Phospho-p70 S6 kinase Thr389 (Cell Signaling Technology

Cat# 9205S, 1:1000, RRID:AB_330944), mouse anti-GAPDH (Millipore Cat# MAB374, 1:2000,

RRID:AB_2107445), mouse anti-Dab1 (Santa Cruz Biotechnology Cat# sc-271136, 1:500,

RRID:AB_10610240), mouse anti-Phosphotyrosine 4G10 (Millipore Cat# 05-1050, 1:1000,

RRID:AB_916371). Membranes were washed and incubated in IRDye 800CW goat anti-mouse IgG (LI-

COR Biosciences Cat# 926-32210, 1:20,000, RRID:AB_621842) and IRDye 680RD goat anti-rabbit IgG

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

(LI-COR Biosciences Cat# 926-68071, 1:20,000, RRID:AB_10956166) for 1 h at room temperature and

imaged using a LI-COR Biosciences Imaging Odyssey Clx System.

Digitonin permeabilization assay

. Primary murine cortical neurons were briefly rinsed with ice-cold PBS

and permeabilized with 150 L of 30 g/mL digitonin (Sigma Cat# D141-100MG) in PBS for 5 min at

C. The supernatant was collected after incubation, and cells were lysed with 200 L RIPA buffer as stated

above. Equal volumes of supernatant and lysate were run on 10% Tris-glycine SDS-PAGE, transferred to

nitrocellulose membrane and immunoblotted for rabbit anti-aldolase A (Proteintech Cat# 11217-1-AP,

1:2000, RRID:AB_2224626) and mouse anti- -actin (Cell Signaling Technology Cat# 3700S, 1:2000,

RRID:AB_2242334) overnight at 4

Immunocytochemistry.

Primary murine hippocampal neurons cultured on 12 mm glass coverslips (Electron

Microscopy Sciences Cat# 72222-01) were briefly rinsed with ice-cold PBS and fixed in 4%

paraformaldehyde (PFA) for 10 min at room temperature. Cells were permeabilized in 0.1% Triton X-100

in PBS for 15 min and blocked in 5% normal goat serum in PBS for 1 h. Primary antibodies used included

mouse anti- -actin (Cell Signaling Technology Cat# 3700S, 1:1000, RRID:AB_2242334), rabbit anti-

Phospho-Cofilin Ser3 (Cell Signaling Technology Cat# 3313S, 1:500, RRID:AB_2080597), or mouse anti-

MAP2 (Millipore Cat# MAB3418, 1:2000, RRID:AB_11212326). To selectively stain F-actin, we use

Alexa Fluor Plus 555 Phalloidin (Thermo Fisher Scientific Cat# A30106, 1:400) in 5% goat serum in PBS

for 1 h at room temperature. Following PBS washes, neurons were incubated with the fluorophore-

conjugated secondary antibodies goat anti-rabbit IgG Alexa Fluor-488 (Thermo Fisher Scientific Cat# A-

11008, 1:500, RRID:AB_143165) and goat anti-mouse IgG Alexa Fluor-546 (Thermo Fisher Scientific

Cat# A-11003, 1:500, RRID:AB_2534071) for 1 h at room temperature. Coverslips were mounted on

Superfrost microscope slides (Fisher Scientific Cat# 12-550-15) in ProLong-Gold Antifade mountant with

DNA stain DAPI (Fisher Scientific Cat# P36931).

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Molecular cloning and lentivirus production.

The shRNA construct for mouse aldolase A was generated

using oligos directed towards the 3’UTR of

Aldoa

(GCCCACTGCCAATAAACAACT) and control

scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene

Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and

in utero

electroporation

experiments, respectively. To generate the lentiviral mouse R42A aldolase A mutant, site directed

mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG;

reverse: CTTCCGGTGGACTCATCT) using the full-length mouse

Aldoa

cDNA (Sino Biological Cat#

MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S). Both aldolase

A wild type and R42A mutant were independently subcloned into pEGFP-C3 using primer set (forward:

ACGGAATTCCAATGCCCCACCCATAC;

reverse:

CCAGGATCCTTAGTAGGCATGGTTAGAGATG), and subsequently subcloned into lentiviral pFUW

vector using primer set (forward: ACGTCTAGAATGGTGAGCAAGGGCGAG; reverse:

CCAGGATCCTTAGTAGGCATGGTTAGAGATG). To generate the lentiviral mouse D33S aldolase A

mutant,

site

directed

mutagenesis

was

performed

with

primer

set

(forward:

GGCTGCATCTGAGTCCACCGGA; reverse: AGGATGCCCTTGCC) using the pFUW-EGFP-aldolase

A wild type construct and Q5 site directed mutagenesis kit. Recombinant lentiviruses were produced by

transfecting HEK293T cells (ATCC Cat# CRL 3216, RRID: CVCL 0063) with pFUW plasmids for EGFP-

aldolase A wild type, EGFP-R42A aldolase A mutant, EGFP-D33S aldolase A mutant, or shRNA constructs

with viral enzymes and envelope proteins (pMDLg/RRE, pRSV-REV and pVSV-G) using FuGENE6

transfection reagent (Promega Cat# E2692). HEK293T media was replaced with Neurobasal media

(Thermo Fisher Scientific Cat# 21103049) supplemented with 2% (v/v) B27 (Thermo Fisher Scientific

Cat# 17504044) 12 h after transfection, and the supernatant was collected 12 h after media change.

Lentivirus-containing conditioned media were centrifuged at 500 x

for 5 min at 4

C to remove cellular

debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly, the supernatant was mixed

with LentiX and incubated for 30 min at 4

C followed by centrifugation at 1500 x

for 45 min at 4

C. The

pellet was resuspended in 10% original volume in Neurobasal and stored at -80

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

In utero electroporation (IUE).

IUE was performed on timed pregnant Crl:CD1 (ICR) dams (strain code:

022, RRID:IMSR_CRL:022) dams at E15.5 as described previously (Gal et al., 2006; Dillon et al., 2017).

Dams were anesthetized with an intraperitoneal injection of a ketamine/xylazine mixture, and the uterine

horns were exposed by midline laparotomy. One to two microliters of plasmid DNA (final concentration

of 1 g/ L) mixed with 0.25% fast green dye (Sigma Aldrich Cat#F7252) was injected into the lateral

ventricles using a pulled glass micropipette. For electroporation, the anode of a Tweezertrode (Harvard

Apparatus) was placed over the dorsal telencephalon above the uterine muscle and four 36 mV pulses (50

ms pulse duration separated by 500 ms interval) were applied with a BTX ECM830 pulse generator

(Harvard Apparatus). Following electroporation, the uterine horns were returned to the abdominal cavity

and filled with warm, sterile 0.9% saline. Absorbable sutures (Havel Cat# HJ398) were used to close the

abdomen and non-absorbable silk sutures (AD Surgical Cat# M-S418R19) were used to stich the skin above

the abdominal wall. Dams were returned to a pre-warmed clean cage and monitored closely during

recovery.

Immunohistochemistry.

Electroporated postnatal (P) day 14 mice were anesthetized with an intraperitoneal

injection of ketamine/xylazine and underwent transcardial perfusion with ice cold 20 mL PBS followed by

20 mL ice cold 4% PFA. Brains were removed and fixed in 4% PFA and 5% sucrose in PBS overnight at

C. Brains underwent cryoprotection through a series of dehydration steps in 10%, 20%, and 30% sucrose

in PBS. Brains were frozen in tissue molds with OCT compound and stored at -80

C. Coronal 40 m brain

sections were cut using a Leica CM1850 cryostat and mounted on SuperFrost microscope slides (Fisher

Scientific Cat# 12-550-15) and stored at -80

C. Prior to immunostaining, sections were brought to room

temperature in the dark and rehydrated using PBS and treated with 0.3% methanol peroxidase for 10 min

to quench endogenous peroxidase activity. Antigen retrieval was performed by microwaving brain sections

in 10 mM sodium citrate buffer pH 6.0 at 900 W for 90 s followed by 100 W for 10 min. Sections were

washed in PBS and blocked in 5% normal goat serum, 0.3% Triton X-100 in PBS for 1 h at room

temperature followed by incubation with rabbit anti-GFP (Synaptic Systems Cat# 132 002, 1:500,

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

RRID:AB_887725) or mouse anti-SATB2 (Abcam Cat# ab51502, 1:200; RRID:AB_882455) and DAPI

to distinguish cortical layers. in 5% goat serum PBS overnight at 4

C. Sections were washed with PBS and

incubated with goat anti-rabbit IgG Alexa Fluor-488 (Thermo Fisher Scientific Cat# A-11008, 1:500,

RRID:AB_143165) for 1 h at room temperature before being mounted with ProLong-Gold with DAPI.

Image acquisition and analysis.

Images were captured using a Carl Zeiss LSM700 scanning confocal

microscope with image acquisition settings kept constant between coverslips in independent experiments

including settings for the laser gain and offset, scanning speed, and pinhole size. To determine fluorescence

intensity in neurites from primary neuron cultures, a maximum intensity projection image of the neuron

was generated through imaging the entire Z-stack of the neuron at 1 µm increments with a 40X oil objective.

The regions of interest were selected manually in each image using well isolated neuronal processes.

Selected neurites were straightened, and the pixel intensity was quantified using National Institutes of

Health ImageJ software (http://imagej.nih.gov/ij). Experimenters were blind to conditions during image

acquisition and analysis. For Sholl analysis, healthy, non-overlapping neurons were chosen to minimize

neurite crossover. Sholl analysis was conducted using the Neuroanatomy and NeuronJ plugins for ImageJ

(Meijering et al., 2004). Concentric circles were spaced 10 µm apart starting from the center of the soma

and extending to the end of the longest neurite. For Sholl analysis from IUE experiments, isolated GFP cell-

filled neurons in primary somatosensory cortex (S1) were chosen. Z-stack images of selected neurons were

acquired using a 25X oil objective and a 0.5 µm interval step. Full Z-stack images were 3D reconstructed

using IMARIS image analysis software, and neuronal processes were manually traced to highlight the

neuronal arborization pattern. Sholl analysis was conducted using concentric circles spaced 1 m apart

starting from the center of the soma and going to the end of the longest traced neurite. For apical neurite

orientation, well isolated neurons in layers 2/3 of S1 were chosen. Maximum intensity projection images

were generated from Z-stack images of neurons taken with a 1 µm step interval using a 25X oil objective.

Apical neurite orientation was determined using NIH ImageJ. A perpendicular line was drawn from the

center of the soma to the pia and a second line following the trajectory of the apical neurite was drawn

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

starting at the soma. The angle between the two lines was used to determine neurite angle to the pia. Apical

neurites were identified as the longest neurites originating at the apex of the soma with a trajectory of < 90°

to the pia. For layering and migration analysis, single plane images of cortical columns spanning the pia to

the white matter in S1 were captured using a 25X oil objective. Using NIH ImageJ, boundaries between

cortical layers were denoted, and the number of GFP positive somas were counted in each layer. To

determine average distance from the pia, a perpendicular line to the pia from the center of GFP labeled

somas was drawn using NIH ImageJ.

Liquid chromatography tandem mass spectrometry.

Primary murine neurons were plated at 2x10

cells/well

in 6 well plates and treated with 50 nM Reelin, mock media control for 30 min or 100 nM GST-RAP for 2

hours prior to Reelin treatment at DIV 7. The media was aspirated and cells were briefly rinsed in ice-cold

PBS and collected in 750 L of ice-cold PBS and centrifuged at 500 x

for 2 min at 4°C. Cell pellets were

snap frozen in liquid nitrogen and stored at -80

C. Samples were resuspended in 200 L of GuHCL lysis

buffer (6 M GuHCL, 100 mM Tris pH 8.0, 40 mM chloroacetamide, 10 mM TCEP) with phosphatase

inhibitor cocktail (Roche Cat# 4906837001) and EDTA free protease inhibitor cocktail (Thermo Fisher

Scientific Cat# P190058) followed by heating to 95°C for 10 min. After brief sonication using a Branson

probe sonicator with 10% power (40 KHz) for 10 s on ice to shear DNA, the samples were quantified

via

BCA assay (Thermo Fisher Scientific Cat# 23225). The samples were diluted with 100 mM Tris, pH 8.5

buffer to bring GuHCL concentration down to 0.75M. Lysate proteins were digested with LC/MS-grade

trypsin (1:50 enzyme to protein ratio, w/w) at 37°C overnight with shaking followed by the addition of

formic acid (FA) to 1% in solution to terminate the trypsinization. The resulting peptides were desalted

using a C18 solid phase extraction Sep-Pak column (SPE, Waters) as per the manufacturer’s instructions.

Briefly, after SPE columns were activated using 90% methanol and pre-conditioned using 0.1% TFA, the

peptide digests were loaded, washed with buffer of 0.1% TFA for 2 times and eluted with 0.1% TFA-60%

acetonitrile. The desalted peptides were dried under vacuum at 45 °C and kept at -20°C prior to tandem

mass tags (TMT) labeling.

Prior TMT labeling, peptide quantification was performed by Pierce quantitative

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

colorimetric assay (Thermo Fisher Cat# P123275). Each sample comprising 100

bated

with TMTPro 16plex reagents (Thermo Fisher Scientific Cat# A44520) as per the manufacturer’s protocol.

Reaction was carried out for 1 h at room temperature. To quench the reaction, 5% hydroxylamine was added

to each sample and incubated for 15 min. Equal amounts of each sample were combined in a new tube and

a speed vac was used to dry the labelled peptide sample. The labelled peptides were desalted using a C18

SPE column. TMT-labeled peptides were then fractionated offline on a Waters XBridge BEH C18 reversed-

mL/min with two buffer lines: buffer A (consisting of 0.1% ammonium hydroxide-2% acetonitrile-water)

and buffer B (consisting of 0.1% ammonium hydroxide-98% acetonitrile, pH 9). The peptides were

separated by a gradient from 0% to 10% B in 5 min followed by linear increases to 30% B in 23 min, to

60% B in 7 min, and then 100% in 8 min and maintained at 100% for 5 min. This separation yielded 48

collected fractions that were subsequently combined into 12 fractions and evaporated to dryness in a

vacuum concentrator. Fractions were kept at -20°C prior to LC-MS analysis. LC-MS analysis was

performed using an Orbitrap Exploris 480 mass spectrometer equipped with FAIMS and interfaced to an

Easy nanoLC1200 system (Thermo Fisher Scientific Cat# LC140). Peptides were loaded onto a C18 pre-

column (3 m,

Fisher Scientific Cat# 16-494-6) then separated on a

reverse-phase nano-spray column (2 m,

Fisher Scientific Cat# 16-

494-6) using gradient elution. Samples (approximately 2 g peptides) were injected and separated over 150

min gradient. The mobile phase A was consisted of 0.1% FA-2% acetonitrile, and mobile phase B was

consisted of 0.1% FA-80% acetonitrile. The gradient consisted of 5% to 30% mobile phase B over 100 min,

was increased to 60% mobile phase B over 20 min then was increased to 99% mobile phase B over 2 min

and maintained at 95% mobile phase B for 5 min at a flow rate of 250 nL/min. The mass spectrometry

of 60,000 with a normalized AGC target of 300% for peptide. The source ion transfer tube temperature was

set at 275°C and a spray voltage set to 2.5kv. Data was acquired on a data dependent mode with FAIMS

running 3 compensation voltages at -50v, -57v and -64v. MS2 scans were performed at 45,000 resolution

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

with a maximum injection time of 80 ms for peptides at normalized collision energy 34. Dynamic exclusion

was enabled using a time window of 60 s.

Proteomic data analysis.

MS2 spectra were processed and searched by MaxQuant (version 1.6) against a

database containing the Uniprot mouse protein sequences (uniprot.org) and reversed (decoy) sequences for

protein identification. The search allowed for two missed trypsin cleavage sites, variable modifications of

methionine oxidation, and N-terminal acetylation. The carbamidomethylation of cysteine residues was set

as a fixed modification. Ion tolerances of 20 and 6 ppm were set for the first and second searches,

respectively. The candidate peptide identifications were filtered assuming a 1% false discovery rate (FDR)

threshold based on searching the reverse sequence database. Quantification was performed using the TMT

reporter on MS2 (TMT pro16-plex). Bioinformatic analysis was performed in the R (version 4.3) statistical

computing environment. Relative intensity of protein groups features was log2 transformed then normalized

by median method. The Limma R package was used for differential analysis (Ritchie et al., 2015) to

generate ranked lists. The differential analysis and comparison between groups was performed using a

Student

-test. Fast Gene Set Enrichment Analysis (fgsea) (Korotkevich et al., 2021) with statistical

significance calculated using 10,000 permutations was used to identify biological terms, pathways and

processes that were co-ordinately up- and down-regulated within each pairwise comparison. FDR cut-off

was set to 0.05 for significant terms. Bar-plots were generated with the ggplot Rpackage using the

normalized enrichment score (NES). The exact p-value, FDR, and NES of GSEA enrichment were included

in supplementary table. The mass spectrometry proteomics raw data have been deposited to the

ProteomeXchange Consortium via the PRIDE repository with the dataset identifier PXD046667.

Quantification and data analysis.

Experimenters were blind to condition during data acquisition and

analysis. Statistical parameters are presented as mean + S.E.M. To determine statistical significance

between groups, unpaired

-test was used to analyze all pairwise datasets and one or two-way analysis of

variance (ANOVA) for parametric analysis of multiple comparisons followed by Tukey’s or Šídák's

post

hoc

test. To determine statistical significance of the Sholl analysis, a two-way ANOVA was used. Analysis

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

was conducted using Prism 8 software (GraphPad Software, RRID:SCR_000306). Significance was set to

< 0.05 for all experiments. Number of experiments and statistical information are reported on the

corresponding result and figure legend sections.

Results

Reelin differentially activates PI3K/Akt and S6K1 phosphorylation across neuron development

We and others have shown when purified recombinant Reelin is added to wild type murine cultured

neurons, Reelin stimulates the phosphorylation of Dab1 and PI3K/Akt signaling pathways at DIV 3 (Beffert

et al., 2002; Jossin and Goffinet, 2007; Leemhuis et al., 2010). Because Reelin signaling activates

overlapping signaling pathways that govern important neuronal development and functions, including

synaptic transmission, it is unclear whether Reelin activates the PI3K/Akt pathways uniformly throughout

neuronal and synaptic development. To address this, we first stimulated primary wild type murine neurons

with 50 nM Reelin or mock control at three developmental time points, DIV 3 (axon outgrowth), DIV 7

(dendritic outgrowth) and DIV 14 (mature synapses) for 30 min and performed Dab1 immunoprecipitation

to monitor Dab1 phosphorylation activity by immunoblotting with an anti-phosphotyrosine antibody. We

demonstrated Reelin consistently increased the levels of phosphorylated Dab1 in immunoprecipitates (lane

2, Fig. 1

A-C

) compared to mock medium (lane 1, Fig. 1

A-C

) at DIV 3, 7 and 14.

Next, we examined whether Reelin induces phosphorylation of Akt (Ser473) and S6K1 (Thr389) across

all three neurodevelopmental time points. At DIV 3, we found a noticeable, although not significant, 49%

increase in Akt phosphorylation following Reelin stimulation (lane 2, Fig. 1

D-E

) compared to mock control

(lane 1, Fig. 1

D-E

). The 67% increase in Akt phosphorylation compared to mock control was insensitive

to the downstream mTORC1 inhibitor rapamycin when neurons were treated 30 min prior to Reelin

stimulation (

= 0.0485, lane 4, Fig. 1

D-E

). As expected, Akt phosphorylation was prevented by inhibition

of upstream PI3K with LY294002 (lanes 5 and 6, Fig. 1

D-E

). In addition, we observed a 160% increase in

S6K1 phosphorylation after Reelin stimulation when compared to mock control (

= 0.0254, lane 2, Fig.

D, F

) at DIV 3, and this effect was inhibited by both rapamycin and LY294002 (lanes 3-6, Fig. 1

D, F

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Likewise, at DIV 7, we observed Akt phosphorylation was increased by 59% after Reelin stimulation

compared to mock control (

= 0.0412, lane 2, Fig. 1

G, H

) and increased to 77% in the presence of

rapamycin (

= 0.0071, lane 4, Fig. 1

G, H

), but was inhibited by PI3K inhibitor LY294002. Reelin

stimulation led to a 46% increase in S6K1 phosphorylation when compared to mock control at DIV 7 (

0.0232, lane 2, Fig. 1

G, I

). By DIV 14, we did not observe any changes in both Akt and S6K1

phosphorylation following Reelin stimulation compared to mock control (Fig. 1

J-L

). These results indicate

that Reelin selectively activates S6K1 phosphorylation through the PI3K/Akt and the mTORC1 complex

pathway during early axonal and dendritic outgrowth but not in mature neurons.

Gene set enrichment analysis support roles of Reelin in regulation of cytoskeleton development and

organization particularly related to actin filament-based process

Since we established Reelin activates the PI3K/Akt and mTORC1 signaling pathway during early

neuronal development, we next wanted to elucidate the proteomic changes induced by Reelin stimulation

during dendritic outgrowth at DIV 7, a period where we observed consistent PI3K/Akt and S6K1

phosphorylation. A preliminary time course in primary murine neurons at DIV 7 demonstrated Reelin

exerted a prominent effect on the proteome at 30 min compared to 3, 6 or 24 h using Label Free

Quantification Mass Spectrometry (LFQ-MS) (Supplementary Fig. 1). To examine the proteomic changes

more extensively at 30 min, we treated DIV 7 primary murine neurons in quadruplicates with four different

conditions: mock control, 50 nM Reelin, 100 nM GST-RAP, or Reelin and GST-RAP and performed liquid

chromatography tandem mass spectrometry (LC-MS/MS) analysis. RAP is a chaperone protein that acts in

the secretory pathway to prevent premature binding of ligands to lipoprotein receptors prior to their

insertion into the cell membrane (Bu and Rennke, 1996; Willnow et al., 1996) . As such, RAP inhibits the

canonical Reelin signaling pathway by preventing Reelin binding to Apoer2 and Vldlr and blocking the

Reelin-induced phosphorylation of Dab1 in primary neurons (Hiesberger et al., 1999). Indeed, we

demonstrated that GST-RAP effectively blocked Reelin-induced Dab1 phosphorylation when primary

murine neurons were treated with 100 nM GST-RAP 2 h prior to Reelin stimulation at DIV 7 (lane 3,

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Supplementary Fig. 2

). With this experimental design, we can detect the following proteomic changes

induced by Reelin: (a) Canonical Reelin signaling by comparing the Reelin-treated group with the Reelin

and RAP-treated group where the difference represents the effect of Reelin signaling

via

the canonical

receptors, Apoer2 and Vldlr which are inhibited by RAP. (b) Non-canonical Reelin signaling by comparing

the Reelin and RAP-treated group with RAP alone where both groups are inhibited from interacting with

the canonical receptors by RAP, so any difference between these groups would primarily be due to signaling

via

non-canonical receptors. (c) Total Reelin signaling that includes both canonical and non-canonical

signaling by comparing the Reelin-treated group with mock control group where the difference represents

the total effect of Reelin regardless of whether the signaling is by canonical or non-canonical receptors.

Using a high-throughput multiplex tandem mass tag (TMT) labeling approach, we identified 6744 total

proteins with a stringent false discovery rate (FDR) < 0.01 across the four conditions. Reelin stimulation

led to significant changes within the proteome when compared to mock control after 30 min (Fig. 2

). In

contrast, GST-RAP treatment regulated protein expression in the opposite direction compared to the Reelin

group (

< 0.05, Fig. 2

), likely due to RAP’s effects on blocking Reelin binding to Apoer2 and Vldlr.

Interestingly, we observed a distinct expression pattern of proteomic changes in the Reelin and GST-RAP

treatment condition indicating Reelin signaling through the non-canonical pathway has a substantial and

distinct impact on the proteome.

To examine how the canonical and non-canonical Reelin pathways differ functionally, we performed

gene set enrichment analysis (GSEA) on the TMT dataset. We ranked all genes according to the extent of

their differential expression between the groups and computed normalized enrichment scores (NES) for the

collection of gene sets representing biological pathways and identified gene sets that are up- and down-

regulated of the ranked list. When we compared the Reelin-treated group with mock control where the

difference represents the total effect of Reelin, we found upregulated pathways related to regulation of

cytoskeleton organization, anatomical structure morphogenesis, dendrite development, protein localization

and transport, cell development and morphogenesis, actin cytoskeleton organization, actin filament-based

process, and neuron projection development (FDR < 0.05, Fig. 2

). In contrast, down-regulated genes

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

belonged to gene sets associated with intraciliary transport, aminoglycan, glycosaminoglycan and

glycosphingolipid metabolic process, and chloride transport (Fig. 2

). Interestingly, a majority of the

upregulated pathways in total Reelin signaling overlapped with canonical Reelin signaling when we

compared the Reelin-treated group with the Reelin and RAP-treated group including regulation of

cytoskeleton organization, dendrite development, protein localization and transport, neuron projection

development and actin filament-based process (Fig. 2

). This also coincided with downregulated pathways

including glycosphingolipid metabolic process and chloride transmembrane transport. This was not

surprising given the preferential binding of Reelin to the lipoprotein receptors Apoer2 and Vldlr. GSEA

also identified gene sets unique to the canonical Reelin signaling pathway, including the upregulation of

RNA processing and positive regulation of gene expression and the downregulation of cytokine production

and regulation of lymphocyte apoptotic process. When we examined non-canonical Reelin signaling by

comparing the Reelin and RAP-treated group with RAP alone, we identified several significantly enriched

gene sets unique to the non-canonical Reelin pathway, including translation, mRNA metabolic process,

ribonucleoprotein complex biogenesis. We noted several downregulated pathways related to respiratory

chain complex IV assembly, appendage and limb development and morphogenesis. We also observed

pathway crosstalk between the canonical and non-canonical Reelin signaling pathways related to regulation

of cytoskeleton and neuron projection development, protein transport and actin filament-based process (Fig.

D-E

). Together, these data show that Reelin stimulation regulates proteomic networks associated with

regulation of anatomical structure morphogenesis and dendrite development, particularly related to actin

filament-based process at DIV 7 (Fig. 2

Reelin stimulation regulates actin dynamics in developing neurites

Because we observed an enrichment of gene sets related to regulation of cytoskeleton development and

organization, including actin filament-based process following Reelin stimulation, we explored whether

Reelin functionally plays a role in actin filament dynamics in developing neurons. To test this, we

stimulated DIV 7 cultured neurons with 50 nM Reelin and performed labeling for phalloidin to probe for

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

filamentous actin (F-actin), a key cytoskeletal component important for cell motility and growth. Reelin

stimulation led to a 23% decrease of phalloidin intensity in neurites when compared to mock control (

0.0001, Fig. 3

A, B

) indicating that Reelin-treated neurons may lead to F-actin remodeling in neurites. To

test whether Reelin’s effects are dependent on the canonical Reelin signaling pathway, we treated neurons

with 100 nM GST-RAP for 2 h prior to Reelin stimulation and found that RAP blocks the Reelin mediated

decrease in phalloidin intensity. Similarly, treating neurons with PI3K inhibitor LY294002 prevented

Reelin mediated effects on phalloidin intensity indicating the Reelin mediated changes in phalloidin

intensity are through the canonical Reelin signaling that requires PI3K activation. We next systematically

examined whether the decrease in phalloidin intensity following Reelin stimulation was localized to

primary or secondary neurites. We observed Reelin stimulation led to a 24% decrease in phalloidin intensity

in primary neurites when compared to mock control (

= 0.0012, Fig. 3

). In addition, we observed

phalloidin intensity in the Reelin stimulated group was 26.7% lower when we compared to the Reelin and

LY294002-treated group in secondary neurites (

= 0.0321 Fig. 3

In contrast, we observed a 45% increase in -actin intensity across all neurites after Reelin stimulation

compared to mock control (

< 0.0001, Fig. 3

E, F

). Likewise, we observed a 37% increase in -actin

intensity in primary neurites

= 0.0059 and a 57% increase in secondary neurites,

= 0.0367 after Reelin

stimulation compared to mock control (Fig. 3

G, H

). However, -actin intensity was not changed in the

presence of GST-RAP or LY294002. Since we did not observe any changes in -actin protein levels by

immunoblotting after Reelin stimulation (Fig. 4

E, H

), it is likely that the increase in -actin intensity seen

by immunofluorescence after Reelin stimulation is an increase in monomeric and/or oligomeric -actin due

to F-actin remodeling and not a result of

de novo

translation of -actin.

To determine whether the cytoskeleton changes we observed were specific to actin remodeling, we

immunolabeled neurons against the microtubule associated protein, MAP2. We did not observe any MAP2

intensity changes across all four treatment conditions in all neurites observed (Fig. 3

I-L

), suggesting

Reelin’s effect on the cytoskeleton was specific to actin remodeling at DIV 7. Together, the increase in -

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

actin intensity in conjunction with the decrease in phalloidin intensity demonstrates the canonical Reelin

signaling modulates actin dynamics in nascent neurites, supporting the proteomic changes we observed

related to regulation of cytoskeleton organization, particularly for actin filament-based processes.

Reelin regulates n-cofilin phosphorylation at serine3 in nascent neurites

After observing that Reelin stimulation leads to a decrease in F-actin, we next asked whether the decrease

is mediated through the actin severing protein, n-cofilin since it has been reported that Reelin signaling

modulates serine3 phosphorylation of n-cofilin (Chai et al., 2009; Leemhuis et al., 2010). A decrease in

phosphorylation at serine3 promotes n-cofilin to sever F-actin which allows for actin rearrangement in cell

motility and navigation (Agnew et al., 1995; Carlier et al., 1997; Ghosh et al., 2004; Bravo-Cordero et al.,

2013; Chen et al., 2015). To test this, we immunolabeled against phospho-cofilin at serine3 in primary

murine neurons following Reelin stimulation for 30 min. We found that Reelin decreased phospho-serine3-

cofilin intensity by 23% when compared to mock control (

= 0.0011, Fig. 4

A, B

). The effect of phospho-

serine3-cofilin intensity after Reelin stimulation was abolished in neurons treated with GST-RAP and

LY294002, indicating that Reelin’s effects on n-cofilin phosphorylation is dependent on the canonical

Reelin pathway. In addition, we found a similar 25% decrease in phospho-serine3-cofilin intensity in

primary neurites after Reelin stimulation compared to mock control (

= 0.0021, Fig. 4

). While not

significant, we observed a 21% decrease in phospho-serine3-cofilin intensity between Reelin and mock in

secondary neurites (

= 0.1692, Fig. 4

). We did; however, observed a significant 27.5% and 32.5 %

decrease in phospho-serine3-cofilin intensity when we compared the Reelin treated group to neurons treated

with GST-RAP (

= 0.0104) and LY294002 (

= 0.0012), respectively (Fig. 4

We also compared the levels of phosphorylated n-cofilin protein from neuronal lysates collected from

DIV 7 primary neurons stimulated with Reelin by immunoblotting for both n-cofilin serine3

phosphorylation and total n-cofilin. Western blot analysis showed that Reelin significantly decreased the

ratio of phosphorylated n-cofilin at serine3 to total cofilin by 31% (

= 0.02, lanes 4-6, Fig. 4

E, F

). However,

we did not observe any effect of Reelin on total cofilin and -actin protein levels (Fig. 4

G, H

). Taken

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

together, our data suggests acute Reelin signaling through the canonical Reelin–PI3K pathway regulates n-

cofilin phosphorylation at serine3 in nascent neurites in culture.

Reelin stimulation leads to

de novo

translation of aldolase A and mobilizes aldolase A from the

cytoskeleton

We identified aldolase A, a glycolytic enzyme and actin-binding protein, from the quantitative proteomic

dataset as a novel effector of the Reelin signaling pathway that may contribute to actin remodeling changes.

Aldolase A was within the regulation of anatomical structure and cell morphogenesis pathway identified

by GSEA. Several supporting evidences suggests aldolase A may play a role in Reelin-mediated neurite

growth. First, aldolase A is a well-known F-actin binding protein shown to regulate cell motility in non-

neuronal cells (Tochio et al., 2010; Ritterson Lew and Tolan, 2013). Second, aldolase A is expressed in the

brain during early developmental time points that are associated with cell migration, growth, and extensive

cytoskeletal reorganization (Weber, 1965; Lebherz and Rutter, 1969; Penhoet et al., 1969). Third, previous

studies have shown that aldolase A and n-cofilin compete for the same binding site on F-actin (Gizak et al.,

2019), and the inhibition of the aldolase A and actin interaction leads to loss of F-actin stress fibers in a n-

cofilin dependent manner (Gizak et al., 2019; Sun et al., 2021). Lastly, aldolase A is an effector of the

insulin-PI3K pathway that regulates epithelial cell’s metabolism through mobilization of aldolase A from

the actin cytoskeleton (Hu et al., 2016). Given that we showed Reelin regulates actin dynamics and n-cofilin

phosphorylation through PI3K signaling pathway, we posit that aldolase A may serve as a molecular

effector of Reelin-mediated neurite growth by regulating actin remodeling dynamics.

To confirm whether Reelin leads to changes in aldolase A protein level expression, neuronal lysates

collected from DIV 7 primary neurons stimulated with 50 nM Reelin or mock for 30 min were

immunoblotted for aldolase A and -actin. Western blot analysis showed that Reelin caused a 22% increase

in aldolase A levels when compared to mock control (

= 0.0342, Fig. 5

A, B

). The effect of aldolase A after

Reelin stimulation was prevented in neurons treated with GST-RAP or LY294002 indicating the increase

in aldolase A protein levels was mediated through the canonical Reelin-PI3K signaling pathway. To

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

determine whether the increase in aldolase A protein levels was a result of

de novo

translation or reduced

protein degradation, DIV 7 neurons were treated with 40 M anisomycin, a translation inhibitor, for 45 min

prior to Reelin stimulation. Western blot analysis showed that Reelin caused a 46.5% increase in aldolase

A levels when compared to mock control (

= 0.0499, Fig. 5

C, D

); however, this was abolished with

anisomycin treatment demonstrating that the increase in aldolase A expression after Reelin stimulation is

due to

de novo

translation. It is important to note that quantitative proteomics is typically based on the

measurement of multiple spectra and peptides per protein that is accompanied by statistical confidence

measures for each peptide, thus it has higher sensitivity of detecting protein changes compared to Western

blotting approaches.

Previous studies had shown that aldolase A is mobilized from the actin cytoskeleton through PI3K

activation in epithelial cells (Hu et al., 2016). To determine whether aldolase A is mobilized from the actin

cytoskeleton through Reelin-PI3K signaling in primary murine neurons, we performed a digitonin

permeabilization assay to allow for efflux of diffusible aldolase A and estimate the fraction of aldolase A

in the soluble versus immobilized state based on separate collection of supernatant and cell lysates,

respectively. DIV 7 neurons were treated with either mock, Reelin, RAP or LY294002 prior to Reelin

stimulation and subsequently permeabilized with digitonin for 5 min at 4

C. We found a 35% increase in

aldolase A in the supernatant fraction induced by Reelin stimulation indicating an increase in mobilized

aldolase A when compared to mock control (

= 0.0337, lanes 3-4, Fig. 5

E, F

). Both RAP and LY294002

prevented the Reelin mediated effect on aldolase A mobilization. In fact, LY294002 reduced aldolase A

mobilization by 39% compared to mock control (

= 0.0111, lanes 7-8, Fig. 5

E, F

). We did not detect any

aldolase A in the supernatant from neurons that were not permeabilized with digitonin which served as a

negative control for the assay (lanes 9-12, Fig. 5

). In summary, these results indicate that the effects of

Reelin on aldolase A levels and mobilization from the cytoskeleton are dependent on the activation of PI3K.

Aldolase A functions downstream of Reelin signaling in regulating dendrite growth

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

To directly test whether aldolase A functions downstream of Reelin signaling, we infected primary

murine neurons with lentiviral

Aldoa

shRNA at DIV 1 to determine the effects of aldolase A knockdown

on dendritic development following Reelin treatment. We found that

Aldoa

shRNA efficiently

downregulated aldolase A protein expression at DIV 7 and resulted in a significant 64% knockdown

compared to

scrambled

(

scr

) control shRNA (

= 0.0179, lane 2, Fig. 6

A, B

). In contrast, infection of

lentiviral

Aldoa

shRNA in neurons had no effect on -actin levels (Fig. 6

A, B

). Since aldolase A is one of

two aldolase isozymes that is expressed in the brain, we also immunoblotted for aldolase C and found no

difference in aldolase C levels demonstrating that

Aldoa

shRNA is specific to aldolase A (Fig. 6

A, B

To investigate whether aldolase A functions downstream of Reelin signaling on dendritic branching,

primary murine neurons were infected at DIV 1 with

scr

Aldoa

shRNA and starting at DIV 4, neurons

were treated with 50 nM Reelin or mock control once a day for 72 h and immunolabeled against dendritic

marker, MAP2 at DIV 7. We performed Sholl analysis to examine global changes in neuronal morphology,

specifically the complexity of the dendritic arbor and the overall pattern of arborization. Sholl analysis

revealed that shRNA knockdown of aldolase A greatly reduced dendritic growth where it shifted the

distribution downward and to the left compared with

scr

shRNA neurons, indicating both a decrease in the

number and length of the neurites (Fig. 6

C, D

). The average total neurite length was 49.5% shorter in

neurons infected with

Aldoa

shRNA compared to

scr

shRNA infected neurons (

< 0.0001, Fig. 6

Similarly, the average maximum neurite length was decreased by 40% in

Aldoa

shRNA infected neurons

(

< 0.0001, Fig. 6

), but had no effect on the average minimum neurite length between

scr

and

Aldoa

shRNA infected neurons (Fig. 6

). Meanwhile, Reelin induced a 32% increase in the average total neurite

length in

scr

shRNA neurons compared to mock control (

< 0.0001, Fig. 6

). Similarly, the average

maximum length of the longest neurite was increased by 31% following Reelin stimulation (

= 0.0002,

Fig. 6

), but had no effect in the average minimum neurite length (Fig. 6

). Interestingly, Reelin

stimulation had no effect in neurons following aldolase A knockdown, indicating that aldolase A lies

downstream of Reelin signaling and is necessary for the effects of Reelin on dendritic outgrowth (Fig. 6

C-

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Aldolase A knockdown disrupts neuronal migration and morphology

in vivo

Since we found aldolase A functions downstream of the Reelin signaling pathway, we next asked

whether aldolase A knockdown impacts neuronal migration and neuronal architecture

in vivo

. To test this,

we performed

in utero

electroporation with GFP-tagged

scr

Aldoa

shRNA on mouse embryos at E15.5

and analyzed both the position of GFP positive cells within the cortical layers and morphology located in

primary somatosensory cortex at P14 to account for uniform distribution of cells along the rostro-caudal

axis. As expected, we found most GFP-positive neurons electroporated with

scr

shRNA were in upper

layers II and III that expressed Satb2 which we used as a marker to distinguish cortical layers for analysis

(Fig. 7

A, B

). Interestingly, we found neurons electroporated with

Aldoa

shRNA distributed deeper within

layers II and III. We, therefore, measured the distance of the soma from the pia and compared neurons

electroporated with

scr

and

Aldoa

shRNA. We found neurons electroporated with

Aldoa

shRNA were 57.75

m deeper in the cortex compared to

scr

electroporated neurons (p < 0.0001, Fig. 7

) suggesting that

aldolase A may play a role in neuronal migration.

We next examined whether aldolase A is necessary for proper neuronal growth and arborization and

performed Sholl analysis on neurons electroporated with

scr

Aldoa

shRNA. Sholl analysis revealed

aldolase A knockdown neurons exhibited a significant reduction in both dendritic length and arbor

complexity compared to

scr

electroporated neurons (

< 0.0001, Fig. 7

D, E

). The average total neurite

length was 65.6% shorter in aldolase A knockdown neurons compared to

scr

electroporated neurons (

0.0001, Fig. 7

). Similarly, the average maximum neurite length was decreased by 53.4% in

Aldoa

shRNA

electroporated neurons (

< 0.0001, Fig. 7

). Interestingly, we found a small and significant increase in the

average minimum neurite length between

scr

and

Aldoa

shRNA electroporated neurons (

= 0.0133, Fig.

Not only did aldolase A knockdown neurons have a significant decrease in neurite length and

arborization, it was apparent they also lacked the apical-basal polarity typical of cortical pyramidal neurons

(Fig. 7

). As such, we measured the length and orientation of the apical dendrite in GFP-positive neurons

scr

control and

Aldoa

shRNA electroporated neurons at P14. Our results demonstrate that aldolase A

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

knockdown caused a 69.24% decrease in the length of the apical dendrite when compared to controls (

0.0001, Fig. 7

). We examined apical dendrite orientation and calculated this as an angle in relation to the

pial surface and binned the data into three groups: 0-30

, 31-60

and 61-90

from the pial surface. Nearly

94.83% of GFP-positive neurons electroporated with

scr

control had their apical dendrite oriented between

0-30

to the pia. However, only 57.26% of aldolase A knockdown neuron kept this normal, apical

orientation (

= 0.017, Fig. 7

). Instead, we found nearly 33.2% of aldolase A knockdown neurons had an

apical dendrite oriented between 31-60

and 9.55% had their apical dendrite between 61-90

, both trending

higher when compared to

scr

control neurons. Altogether, these data support the conclusion that aldolase

A is necessary for proper neuron arborization and is, particularly important for the growth and orientation

of the apical dendrite of pyramidal neurons in the mouse cortex.

Aldolase A requires actin binding activity for proper neuronal arborization

Because aldolase A serves as both a glycolytic enzyme and actin binding protein, it is in a unique position

to regulate the metabolic demands and the structural rearrangements of the cytoskeleton necessary for the

energy intensive process of neurite growth and arborization. To determine which functional activity of

aldolase A is required for proper neuronal arborization, we examined two aldolase variants defective in

either glycolytic (D33S) or actin-binding activity (R42A) that have been previously characterized in non-

neuronal cells (Wang et al., 1996; Ritterson Lew and Tolan, 2012, 2013; Hu et al., 2016). The D33S aldolase

A variant is catalytically dead but retains F-actin binding activity; whereas the R42A variant abolishes the

F-actin binding activity but retains glycolytic activity. We generated three lentiviral aldolase A constructs:

wild type, D33S and R42A and we titered each lentivirus uniformly to perform rescue experiments of

aldolase A’s knockdown effects on dendritic arborization. Primary murine neurons were infected on DIV

1 and we performed immunolabeling against MAP2 at DIV 7. We compared the effects of

scr

shRNA,

Aldoa

shRNA,

Aldoa

shRNA rescued with mouse aldolase A wild type, catalytically dead D33S or actin-

binding deficient R42A variant. The

Aldoa

shRNA-mediated knockdown of aldolase A decreased neurite

arborization compared to

scr

shRNA (

< 0.0001, Fig. 8

A, B

). Both aldolase A wild type and catalytically

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

dead D33S rescued the

Aldoa

shRNA phenotype, whereas the actin-binding deficient R42A was unable to

rescue the neurite arborization effects of aldolase A knockdown on dendritic outgrowth (Fig. 8

A, B

We systematically measured the average total, maximum and minimum neurite length between the

conditions. The average total neurite length was 57.4% shorter in neurons infected with

Aldoa

shRNA

compared to

scr

-infected neurons (

< 0.0001, Fig. 8

). Lentiviral infection with aldolase A wild type and

catalytically dead D33S variant fully rescued the effects of aldolase A knockdown phenotype (

< 0.0001,

Fig. 8

). In contrast, the actin-binding deficient R42A variant led to a 47.8% reduction in average total

neurite length compared to

scr

shRNA and was unable to rescue the aldolase A knockdown phenotype (

< 0.0001, Fig. 8

). Similarly, the average maximum neurite length was decreased by 44.9% in

Aldoa

shRNA infected neurons (

< 0.0001, Fig. 8

). Both aldolase A wild type and D33S fully rescued the

Aldoa

shRNA phenotype (

< 0.0001, Fig. 8

); however, the R42A variant was unable to rescue the maximum

neurite length following aldolase A knockdown when compared to

scr

shRNA control (

= 0.0002, Fig.

). Likewise, the average minimum length of the shortest neurite was rescued by the catalytically dead

D33S aldolase A variant (

= 0.0152, Fig. 8

). Together, these results provide strong evidence that the actin

binding function of aldolase A is a key regulator controlling dendritic outgrowth.

Discussion

(1061/1500 words)

In this study, we showed Reelin selectively activates S6K1 phosphorylation through the PI3K/Akt and

mTORC1 complex pathways during initial stages axonal and dendritic outgrowth, a process that differs in

mature neurons in culture (Fig. 1). This aligns with previous studies that demonstrated Reelin signaling to

PI3K/Akt is necessary for Reelin-induced neurite outgrowth (Beffert et al., 2002; Jossin and Goffinet, 2007;

Leemhuis et al., 2010). Through an unbiased proteomics analysis to delineate between canonical and non-

canonical Reelin signaling during dendritic outgrowth in primary murine neurons, we found significant

crosstalk related to cytoskeleton regulation, neuron projection development and actin filament-based

processes (Fig. 2). Notably, gene sets influenced by the non-canonical Reelin pathway include protein

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

translation, mRNA metabolic processes and ribonucleoprotein complex biogenesis, highlighting distinct

impacts on neuronal structure and function.

We explored how Reelin specifically influences actin dynamics in dendritic development (Fig. 3). We

showed that Reelin stimulation reduces F-actin intensity while increasing total -actin intensity in

developing neurites. However, this increase in -actin was not corroborated by Western blot analysis,

suggesting the changes we observed in immunocytochemistry might be due to an increase in monomeric

actin following F-actin depolymerization which will need to further examined. Accompanying these

changes was a reduction in cofilin

serine3 phosphorylation (Fig. 4), indicating enhanced cofilin severing

activity. This suggests that Reelin promotes cofilin-mediated actin depolymerization and rearrangement in

neurites

in vitro

, in contrast to previous studies that indicated Reelin signaling through PI3K increased

cofilin serine3 phosphorylation, stabilizing the actin cytoskeleton in the leading processes of migrating

neurons during embryonic mouse brain development (Chai et al., 2009; Frotscher et al., 2017). We posit

Reelin’s dual role in modulating cofilin activity, either inhibiting or promoting cofilin severing activity,

depending on the developmental stage. Reelin inhibits cofilin severing activity and stabilize the actin

cytoskeleton to act as a stop signal for migrating neurons which is required for orientation and directed

migration of cortical neurons (Chai et al., 2009), but it could also function to promote cofilin severing

activity by decreasing cofilin serine3 phosphorylation to allow for actin rearrangements essential for neurite

outgrowth and arborization.

Reelin is a commanding regulator on dendritic growth during different stages of brain development,

particularly in embryonic and postnatal stages. Previous studies have shown that dendritic growth of

pyramidal cells is disrupted in both homozygous and heterozygous

reeler

mice (Pinto Lord and Caviness,

1979; Niu et al., 2004). Addition of Reelin

in vitro

has been shown to increase dendritic growth of

hippocampal neurons in both wild type and

reeler

mutant mice (Niu et al., 2004; Jossin and Goffinet, 2007;

Matsuki et al., 2008). This enhancement of dendritic growth by Reelin is evident during early brain

development (Nichols and Olson, 2010; Kupferman et al., 2014; Chai et al., 2015; Kohno et al., 2015;

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

O'Dell et al., 2015). Our current study aligns with these findings, focusing on the

in vitro

effects of Reelin

on the dendritic growth and branching of embryonic hippocampal neurons. However, Reelin exerts an

opposing effect on dendritic growth in cortical pyramidal neurons and forebrain interneurons during

postnatal development (Yabut et al., 2007; Chameau et al., 2009; Hamad et al., 2021). Specifically, the N-

terminal fragment of Reelin has been shown to control and restrict the postnatal maturation of apical

dendrites in pyramidal cortical neurons, a process mediated by integrin receptors (Chameau et al., 2009).

This suggests that the postnatal effects of Reelin might be attributed to the differential impact of its

proteolytic fragments interacting with non-canonical receptors. Our work contributes to the growing body

of evidence on the role of Reelin in dendritic development. We provide proteomic changes into how both

canonical and non-canonical Reelin pathways regulate dendrite growth in embryonic cultured neurons.

However, it remains unclear whether these

in vitro

observations fully reflect the

in vivo

mechanisms and

effects of Reelin on dendritic development across various stages of brain maturation.

Our proteomics screen identified aldolase A, a glycolytic enzyme and actin-binding protein, as a critical

component in Reelin-mediated actin dynamics (Arnold and Pette, 1968; Arnold et al., 1971; Wang et al.,

1996; Kusakabe et al., 1997; Jewett and Sibley, 2003). We demonstrated that Reelin stimulates

de novo

translation of aldolase A, mobilizing soluble aldolase A from the cytoskeleton, linking aldolase A directly

to Reelin signaling and its novel role in neuronal development (Fig. 5). We show downregulation of

aldolase A in primary murine neurons led to shorter, less branched dendrites, and Reelin treatment was

ineffective following aldolase A knockdown, indicating aldolase A is necessary for Reelin’s effects on

dendritic growth. Similar results were observed in cortical neurons in the developing mouse brain, with

impaired neuronal migration, aberrant length, arborization and orientation of the apical dendrite (Fig. 7),

reinforcing the essential role of aldolase A in proper neuron development.

We further investigated aldolase A’s dual functions in neurite outgrowth and demonstrated that the actin-

binding ability of aldolase A, rather than its glycolytic function, is critical for neurite development using

site-directed variants of aldolase A (Fig. 8). As previously characterized, the D33S aldolase variant is

catalytically dead and retains F-actin binding ability while the R42A mutant is catalytically active and

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

unable to bind F-actin (Wang et al., 1996; Ritterson Lew and Tolan, 2013; Hu et al., 2016). We

demonstrated that both the wild type and catalytically inactive D33S aldolase variant, which retains F-actin

binding ability, rescued the effects of

Aldoa

shRNA knockdown phenotype in primary neurons, while the

R42A mutant, unable to bind F-actin, showed impaired neurite growth and arborization. This finding

reinforces aldolase A’s role in cell growth and motility, independent of its glycolytic activity, in non-

neuronal cells as observed in previous studies (Tochio et al., 2010; Ritterson Lew and Tolan, 2012, 2013;

Gizak et al., 2019). Our data provides a direct link between aldolase A and neuronal development

downstream of Reelin signaling, establishing a new functional role for aldolase A in neurons and expanding

our understanding of how Reelin regulates actin filament dynamics related to dendrite growth.

In summary, our data elucidates how Reelin canonical and non-canonical signaling pathways uniquely

affect neuronal structure and function

in vitro

. We demonstrate Reelin’s acute regulation of the actin

cytoskeleton, highlighting aldolase A’s pivotal role as an actin binding protein which establishes an

unrecognized function of aldolase A in the brain. We propose a model where Reelin modulates cofilin

serine3 phosphorylation, facilitating aldolase A’s mobilization and enabling cofilin-dependent actin

depolymerization and rearrangement essential for neurite extension and arborization.

Figure Legends:

Figure 1.

Reelin selectively activates the PI3K/Akt and S6K1 pathway in primary murine neurons at early

developmental time points.

A-C,

Representative immunoblots showing phospho-tyrosine levels after Dab1

immunoprecipitation (IP) from primary murine neurons treated with 50 nM Reelin or mock control for 30

min at DIV 3, 7, and 14. Total Dab1 and GAPDH serve as loading controls (input).

Representative

immunoblots from DIV 3 neuronal lysates stimulated for 30 min with mock control (lanes 1, 3, 5) or with

50 nM Reelin (lanes 2, 4, 6). DIV 3 neuronal cultures were also incubated with 200 nM rapamycin (lanes

3, 4) or 50 M LY294002 (lanes 5, 6) 30 min prior to Reelin stimulation. Cell lysates were immunoblotted

for phosphorylated S473 Akt, total Akt, phosphorylated T389 S6K1, total S6K1, and GAPDH that serves

as loading control.

Bar graph quantification for the ratio of phosphorylated S473 Akt with total Akt from

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

shows an increase in Akt phosphorylation following Reelin stimulation that was inhibited by LY294002

[one-way ANOVA, F (5, 12) = 24.55,

< 0.0001].

Bar graph quantification for the ratio of

phosphorylated T389 S6K1 with total S6K1 from

shows an increase in S6K1 phosphorylation following

Reelin stimulation that was inhibited by rapamycin and LY294002 [one-way ANOVA, F (5, 12) = 11.71,

= 0.0003].

Representative immunoblots from DIV7 neuronal lysates with the same treatment

conditions as described in

Bar graph quantification for the ratio of phosphorylated S473 Akt with

total Akt from

[one-way ANOVA, F (5, 12) = 39.74,

< 0.0001].

Bar graph quantification for the ratio

of phosphorylated T389 S6K1 with total S6K1 from

[one-way ANOVA, F (5, 12) = 52.55,

< 0.0001].

Representative immunoblots from DIV 14 neuronal lysates with the same treatment conditions as

described in

Bar graph quantification for the ratio of phosphorylated S473 Akt with total Akt from

[one-way ANOVA, F (5, 12) = 15.41,

< 0.0001].

Bar graph quantification for the ratio of

phosphorylated T389 S6K1 with total S6K1 from

[one-way ANOVA, F (5, 12) = 14.42,

= 0.0001].

Quantifications are from n = 3 individual replicates for each treatment condition and time point.

Figure 2.

Proteomic analysis of acute Reelin signaling.

Primary murine neurons at DIV 7 were treated with

mock control, 50 nM Reelin for 30 min, 100 nM GST-RAP for 2 h, or Reelin with GST-RAP (2 h prior to

30 min Reelin stimulation) and subject to TMT LC-MS/MS.

Heatmap of proteome clusters indicating

differentially-expressed proteins (rows) that are significantly upregulated (red) and downregulated (blue).

Two-side bar plot of GSEA pathways identified from the Reelin and mock control comparison with FDR

< 0.05. The numbers at the bottom are normalized enrichment scores (NES) for the corresponding biological

pathway categories that are up- and down-regulated of the ranked list.

Two-side bar plot of GSEA

pathways identified from the Reelin and Reelin with RAP comparison with FDR < 0.05 representing the

canonical Reelin pathway.

Two-side bar plot of GSEA pathways identified from the Reelin with RAP

and RAP alone comparison with FDR < 0.05 representing the non-canonical Reelin pathway.

Gene

ranking plot of several developmental and cytoskeletal associated pathways enriched in Reelin stimulation

compared to mock control,

0.02.

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Figure 3.

Reelin stimulation regulates actin remodeling in developing neurites. Primary murine neurons at

DIV 7 were treated with mock control, 50 nM Reelin, 100 nM GST-RAP for 2 h prior to Reelin or 50 M

LY294002 for 30 min prior to Reelin stimulation (30 min).

Representative images of neurons labeled

with phalloidin showed a decrease in phalloidin intensity in neurites following Reelin stimulation.

Bar

graph quantification of fluorescent phalloidin intensity in all neurites normalized to mock control [one-way

ANOVA, F (3, 423) = 7.879,

< 0.0001].

Bar graph quantification of phalloidin intensity in primary

neurites normalized to mock control [one-way ANOVA, F (3, 239) = 4.820,

= 0.0028].

Bar graph

quantification of phalloidin intensity in secondary neurites normalized to mock control [one-way ANOVA,

F (3, 180) = 3.307, p = 0.0214]. n = 5 independent experiments with n = 15-26 neurons per condition

analyzed.

Representative images immunostained for beta-actin ( -actin) showed an increase in -actin

intensity in neurites following Reelin stimulation.

Bar graph quantification of fluorescent -actin

intensity in all neurites normalized to mock control [one-way ANOVA, F (3, 302) = 9.658, p < 0.0001].

Bar graph quantification of -actin intensity in primary neurites normalized to % mock control [one-way

ANOVA, F (3, 171) = 4.695, p = 0.0035].

Bar graph quantification of -actin intensity in secondary

neurites normalized to mock control [one-way ANOVA, F (3, 127) = 3.227, p = 0.0248]. n = 3 independent

experiments with n = 15-16 neurons per condition analyzed.

Representative images immunostained for

MAP2.

Bar graph quantification of fluorescent MAP2 intensity in all neurites normalized to mock control

[one-way ANOVA, F (3, 414) = 1.950, p = 0.1208].

Bar graph quantification of MAP2 intensity in

primary neurites normalized to mock control [one-way ANOVA, F (3, 220) = 1.010, p = 0.3891].

Bar

graph quantification of MAP2 intensity in secondary neurites normalized to mock control [one-way

ANOVA, F (3, 191) = 1.652. p = 0.1788]. n = 3 independent experiments with n = 16-18 neurons per

condition analyzed. Scale bars for

A, E, I

= 10 m.

Figure 4.

Reelin reduces n-cofilin phosphorylation at Ser3.

Primary murine neurons at DIV 7 were

treated with mock control, 50 nM Reelin, 100 nM GST-RAP for 2 h prior to Reelin or 50 M LY294002

for 30 min prior to Reelin stimulation (30 min). Representative images immunostained for phospho-cofilin

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

at Ser3 showed a decrease in phospho-cofilin in neurites following Reelin stimulation. Scale bar = 10 m.

Bar graph quantification of fluorescent phospho-cofilin intensity in all neurites normalized to mock

control [one-way ANOVA, F (3, 383) = 8.602, p < 0.0001].

Bar graph quantification of phospho-cofilin

intensity in primary neurites normalized to % mock control [one-way ANOVA, F (3, 203) = 5.540, p =

0.0011].

Bar graph quantification of phospho-cofilin intensity in secondary neurites normalized to mock

control [one-way ANOVA, F (3, 176) = 5.500, p = 0.0012]. n = 3 independent experiments with n = 14-16

neurons per condition analyzed.

Representative immunoblots from DIV 7 neuronal lysates treated with

50 nM Reelin or mock control for phospho-cofilin at Ser3, total n-cofilin and -actin.

Bar graph

quantification for the ratio of phosphorylated cofilin at Ser3 with total cofilin from

shows a decrease in

cofilin phosphorylation following Reelin stimulation [Unpaired

-test, t = 2.763, df = 10,

= 0.0200].

G-H,

Bar graph quantification for total cofilin and -actin, respectively. n = 6-10 individual replicates.

Figure 5.

Aldolase A undergoes

de novo

translation and mobilizes from the cytoskeleton in response to

Reelin stimulation.

Representative immunoblots of DIV 7 neuronal lysates treated with mock control,

50 nM Reelin, 100 nM GST-RAP for 2 h prior to Reelin or 50 M LY294002 for 30 min prior to Reelin

stimulation for aldolase A and -actin.

Bar graph quantification of aldolase A normalized to mock control

showed an increase in aldolase A protein levels after Reelin stimulation [one-way ANOVA, F (3, 29) =

8.998, p = 0.0002]. n = 7-9 individual replicates.

Representative immunoblots of DIV 7 neuronal lysates

treated with mock control (lanes 1-3), 50 nM Reelin (lanes 4-6) or 40 M anisomycin for 45 min prior to

Reelin stimulation (lanes 7-9) for aldolase A and -actin.

Bar graph quantification of aldolase A

normalized to mock control showed an increase in aldolase A protein levels after Reelin stimulation but not

in anisomycin-treated neurons [one-way ANOVA, F (2, 25) = 4.275, p = 0.0253]. n = 8-10 individual

replicates.

Representative immunoblots of DIV 7 neuronal lysates treated with mock control, 50 nM

Reelin, 100 nM GST-RAP for 2 h prior to Reelin or 50 M LY294002 for 30 min prior to Reelin stimulation

and subject to digitonin permeabilization (lanes 1-8). Supernatant (SN) and cell lysate were subject to

immunoblotting for aldolase A and -actin as indicated.

Quantification of aldolase A in the diffusible

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

fraction (supernatant) to immobile (cell lysate) fraction show an increase in aldolase A in response to Reelin

stimulation [one-way ANOVA, F (3, 41) = 10.45, p < 0.0001]. n = 9-15 individual replicates.

Figure 6.

Aldolase A is necessary for Reelin-mediated neurite outgrowth and arborization.

Primary murine

neurons on DIV 1 were infected with

scr

Aldoa

shRNA and analyzed at DIV 7.

Representative

immunoblots showing aldolase A and aldolase C levels from DIV 7 neuronal lysate after infection with

scr

Aldoa

shRNA. -actin served as loading control.

Bar graph quantifications of aldolase A, aldolase C,

and -actin expression normalized to

scr

shRNA showed decreased protein level specifically for aldolase

A [Unpaired

t-test

t = 3.874, df = 4,

= 0.0179]. n = 3 individual replicates.

Representative images of

DIV 7 neurons infected with

scr

Aldoa

shRNA and stimulated with either mock control or 50 nM Reelin

once a day for 72 h starting at DIV 4 and immunostained against MAP2 at DIV 7. Scale bar = 12.5 m.

Sholl analysis comparing neuronal arborization complexity between

scr

Aldoa

shRNA with mock and

Reelin treatment showed reduced dendritic growth and arborization in aldolase A knockdown neurons and

Reelin stimulation had no effect in neurons following aldolase A knockdown [two-way ANOVA, F (54,

2793) = 21.80,

< 0.0001]. n = 3 independent experiments with n = 30-42 cells per condition analyzed.

Bar graph quantification of the average total neurite sum length [one-way ANOVA, F (3, 157) = 89.41,

< 0.0001].

Bar graph quantification of the average maximum neurite sum length [one-way ANOVA, F

(3, 158) = 46.06,

< 0.0001].

Bar graph quantification of the average minimum neurite length [one-way

ANOVA, F (3, 158) = 5.149,

= 0.0020]. For

E-G

, n = 3 independent experiments with n = 32-44 cells per

condition analyzed.

Figure 7.

Aldolase A is required for neuronal arborization and apical dendrite polarity in the mouse cortex.

Mouse embryos were electroporated

in utero

with GFP-tagged

scr

control or

Aldoa

shRNA at E15.5 and

analyzed at P14.

Representative images of brain sections electroporated with GFP-tagged

scr

control or

Aldoa

shRNA and immunostained against GFP and Satb2 to visualize electroporated cells and marker to

distinguish cortical layers in somatosensory S1 cortex, respectively. Scale bar = 175 m.

Bar graph

quantification showing the percentage of GFP-positive neurons across cortical layers between

scr

and

Aldoa

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

shRNA electroporated neurons. n = 3 mice per group with n = 402-639 cells per group analyzed.

Bar

graph quantification showing the average soma depth of GFP-positive electroporated neurons from the pia

showed aldolase A knockdown neurons reside deeper in the cortex compared to

scr

electroporated neurons

[Unpaired

-test, t = 7.889, df = 556,

< 0.0001]. n = 3 brains per group with n = 264-294 cells per group

analyzed.

Representative images of GFP-positive neurons in layers II/III of S1 from brains

electroporated at E15.5 with

scr

Aldoa

shRNA showing the disrupted morphology and arborization of

aldolase A knockdown neurons compared to

scr

control. Scale bar = 25 m.

Sholl Analysis showed

aldolase A knockdown neurons have shorter total neurite length and less neuronal arborization compared

scr

control neurons. A two-way ANOVA was used to determine the statistical significance of the

interaction between the length of the neurites and number of crossings at each radius for each treatment

condition [two-way ANOVA F (222, 14718) = 14.06,

< 0.0001]. n = 3 brains per condition and n = 31-

37 neurons per condition analyzed.

Bar graph quantification showing aldolase A knockdown neurons

led to a decrease in the average neurite sum length compared to

scr

control electroporated neurons

[Unpaired

-test, t = 6.478, df = 63,

< 0.0001].

Bar graph quantification of the average maximum

neurite length between

scr

and

Aldoa

shRNA electroporated neurons [Unpaired

-test, t = 7.272, df = 62,

< 0.0001].

Bar graph quantification of the average minimum neurite length between

scr

and

Aldoa

shRNA electroporated neurons [Unpaired

-test, t = 2.559, df = 55,

= 0.0133]. For

F-H

, n = 3 brains per

group with n = 25-35 neurons analyzed.

Representative images of GFP-positive neurons in layers II/III

of S1 from brains electroporated with either

scr

Aldoa

shRNA (left panel) and IMARIS generated 3D

wire structure reconstruction of the same neurons (right panel) showing their morphology and apical neurite

orientation and length is altered in aldolase A knockdown neurons. Scale bar = 25 m.

Bar graph

quantification showing a reduction in the average length of apical neurites for aldolase A knockdown

neurons [Unpaired

-test, t = 6.164, df = 65,

< 0.0001]. n = 3 brains per group and n = 33-34 neurons

analyzed.

Percentage of GFP-positive neurons with an apical dendrite oriented between 0-30

, 31-60

and 61-90

to the pia were quantified. Quantification revealed control electroporated neurons have apical

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

dendrites oriented mostly within 0-30

compared to aldolase A knockdown neurons [two-way ANOVA, F

(2, 12) = 9.129,

= 0.0039]. n = 3 brains per group with n = 30-35 neurons analyzed.

Figure 8.

Aldolase A requires actin binding function to regulate proper neuronal arborization.

Representative images of DIV 7 neurons immunostained against MAP2 infected with

scr

shRNA,

Aldoa

shRNA, or

Aldoa

shRNA rescue with aldolase A wild type (WT), D33S, or R42A variant on DIV1. Scale

bar = 25 µm.

Sholl analysis showed

Aldoa

shRNA infected neurons exhibit reduced dendritic length and

arborization compared to

scr

control. Lentiviral infection with aldolase WT or D33S variant rescued

Aldoa

shRNA induced phenotype while R42A variant was unable to rescue the phenotype. Two-Way ANOVA

analysis used to determine statistical significance of the interaction between neurite length and number of

intersections at each radius for each condition [two-way ANOVA, F (72, 3230) = 14.70,

< 0.0001]. n = 3

independent experiments with n = 34-36 cells analyzed per condition.

Bar graph quantification of the

average total neurite sum length One-Way ANOVA used to determine statistical significance [one-way

ANOVA F (4, 170) = 63.91,

< 0.0001].

Bar graph quantification of the average maximum neurite sum

length [one-way ANOVA F (4, 168) = 36.06,

< 0.0001].

Bar graph quantification of the average

minimum neurite length [one-way ANOVA F (4, 165) = 4.176,

= 0.003]. For

C-E

, n = 3 independent

experiments with n = 33-36 neurons analyzed per condition.

Supplementary Figure 1.

Label free quantification proteomics analysis of Reelin time-course treatment

on wild type neurons at DIV 7. Each column represents an individual sample with duplicate treatments

grouped together. Heatmap showing differentially expressed features identified with an FDR < 0.05.

Feature intensity is represented as a Z-score between +2 (Yellow) and -2 (Blue), higher Z-scores correspond

to greater relative expression while lower Z-scores correspond to lower relative expression. Dendrogram

clustering groups treatment conditions by the similarity of the proteomic profile

Supplementary Figure 2.

GST-RAP inhibits Dab1 phosphorylation.

Coomassie showing fractions

taken from GST-RAP production and purification.

Representative immunoblot of tyrosine-

phosphorylated Dab1 immunoprecipitated from DIV 7 primary murine neurons demonstrating GST-RAP

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

prevented Reelin-induced Dab1 phosphorylation. Neurons were treated with 50 nM Reelin or mock control

for 30 min or 100 nM GST-RAP for 2 h prior to 30 min Reelin treatment.

References

Agnew BJ, Minamide LS, Bamburg JR (1995) Reactivation of phosphorylated actin depolymerizing factor
and identification of the regulatory site. The Journal of Biological Chemistry 270:17582-17587.

Arnaud L, Ballif BA, Forster E, Cooper JA (2003) Fyn Tyrosine Kinase Is a Critical Regulator of Disabled-

1 during Brain Development. Current Biology 13:9-17.

Arnold H, Pette D (1968) Binding of glycolytic enzymes to structure proteins of the muscle. Eur J Biochem

6:163-171.

Arnold H, Henning R, Pette D (1971) Quantitative comparison of the binding of various glycolytic enzymes

to F-actin and the interaction of aldolase with G-actin. European Journal of Biochemistry 22:121-
126.

Bal M, Leitz J, Reese AL, Ramirez DM, Durakoglugil M, Herz J, Monteggia LM, Kavalali ET (2013)

Reelin mobilizes a VAMP7-dependent synaptic vesicle pool and selectively augments spontaneous
neurotransmission. Neuron 80:934-946.

Beffert U, Morfini G, Bock HH, Reyna H, Brady ST, Herz J (2002) Reelin-mediated signaling locally

regulates protein kinase B/Akt and glycogen synthase kinase 3beta. The Journal of Biological
Chemistry 277:49958-49964.

Beffert U, Weeber EJ, Durudas A, Qiu S, Masiulis I, Sweatt JD, Li WP, Adelmann G, Frotscher M, Hammer

RE, Herz J (2005) Modulation of synaptic plasticity and memory by Reelin involves differential
splicing of the lipoprotein receptor Apoer2. Neuron 47:567-579.

Bock HH, Herz J (2003) Reelin activates SRC family tyrosine kinases in neurons. Curr Biol 13:18-26.

Bosch C, Muhaisen A, Pujadas L, Soriano E, Martínez A (2016) Reelin Exerts Structural, Biochemical and

Transcriptional Regulation Over Presynaptic and Postsynaptic Elements in the Adult
Hippocampus. Front Cell Neurosci 10:138.

Bouche E, Romero-Ortega MI, Henkemeyer M, Catchpole T, Leemhuis J, Frotscher M, May P, Herz J,

Bock HH (2013) Reelin induces EphB activation. Cell Research 23:473-490.

Bravo-Cordero JJ, Magalhaes MA, Eddy RJ, Hodgson L, Condeelis J (2013) Functions of cofilin in cell

locomotion and invasion. Nature Reviews Molecular Cell Biology 14:405-415.

Bu G, Rennke S (1996) Receptor-associated protein is a folding chaperone for low density lipoprotein

receptor-related protein. The Journal of Biological Chemistry 271:22218-22224.

Carlier MF, Laurent V, Santolini J, Melki R, Didry D, Xia G, Hong Y, Chua NH, Pantolini D (1997) Actin

Depolymerizing Factor (ADF/Cofilin) Enhances the Rate of Filament Turnover: Implication in
Actin-based Motility. The Journal of Cell Biology 136:1307-1323.

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Caviness VS, Jr. (1976) Patterns of cell and fiber distribution in the neocortex of the reeler mutant mouse.

J Comp Neurol 170:435-447.

Chai X, Forster E, Zhao S, Bock HH, Frotscher M (2009) Reelin stabilizes the actin cytoskeleton of

neuronal processes by inducing n-cofilin phosphorylation at serine3. The Journal of Neuroscience
29:288-299.

Chai X, Fan L, Shao H, Lu X, Zhang W, Li J, Wang J, Chen S, Frotscher M, Zhao S (2015) Reelin Induces

Branching of Neurons and Radial Glial Cells during Corticogenesis. Cereb Cortex 25:3640-3653.

Chameau P, Inta D, Vitalis T, Monyer H, Wadman WJ, van Hooft JA (2009) The N-terminal region of

reelin regulates postnatal dendritic maturation of cortical pyramidal neurons. Proc Natl Acad Sci U
S A 106:7227-7232.

Chen Q, Courtemanche N, Pollard TD (2015) Aip1 promotes actin filament severing by cofilin and

regulates constriction of the cytokinetic contractile ring. The Journal of Biological Chemistry
290:2289-2300.

Chen Y, Beffert U, Ertunc M, Tang TS, Kavalali ET, Bezprozvanny I, Herz J (2005) Reelin modulates

NMDA receptor activity in cortical neurons. The Journal of Neuroscience 25:8209-8216.

Curran T, D'Arcangelo G (1998) Role of reelin in the control of brain development. Brain Res Brain Res

Rev 26:285-294.

D'Arcangelo G, Miao GG, Chen SC, Soares HD, Morgan JI, Curran T (1995) A protein related to

extracellular matrix proteins deleted in the mouse mutant

reeler

. Nature 374:719-723.

Dillon GM, Tyler WA, Omuro KC, Kambouris J, Tyminski C, Henry S, Haydar TF, Beffert U, Ho A (2017)

CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development. Neuron 93:1344-1358
e1345.

Dulabon L, Olson EC, Taglienti MG, Eisenhuth S, McGrath B, Walsh CA, Kreidberg JA, Anton ES (2000)

Reelin Binds a3b1 Integrin and Inhibits Neuronal Migration. Neuron 27:33-44.

Frotscher M, Zhao S, Wang S, Chai X (2017) Reelin Signaling Inactivates Cofilin to Stabilize the

Cytoskeleton of Migrating Cortical Neurons. Front Cell Neurosci 11:148.

Gal JS, Morozov YM, Ayoub AE, Chatterjee M, Rakic P, Haydar TF (2006) Molecular and morphological

heterogeneity of neural precursors in the mouse neocortical proliferative zones. The Journal of
Neuroscience 26:1045-1056.

Ghosh M, Song X, Mouneimne G, Sidani M, Lawrence DS, Condeelis JS (2004) Cofilin Promotes Actin

Polymerization and Defines the Direction of Cell Motility. Science 304:743-746.

Gizak A, Wisniewski J, Heron P, Mamczur P, Sygusch J, Rakus D (2019) Targeting a moonlighting

function of aldolase induces apoptosis in cancer cells. Cell Death and Disease 10:712.

Grayson DR, Jia X, Chen Y, Sharma RP, Mitchell CP, Guidotti AR, Costa E (2005) Reelin promoter

hypermethylation in schizophrenia. Proceedings of the National Academy of Sciences 102:9341-
9346.

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Guidotti AR, Auta J, Davis JM, Gerevini VD, Dwivedi Y, Grayson DR, Impagnatiello F, Pandey G, Pesold

C, Sharma RP, Uzunov D, Costa E (2000) Decrease in Reelin and Glutamic Acid Decarboxylase

(GAD

) Expression in Schizophrenia and Bipolar Disorder. Archives of General Psychiatry

57:1061-1069.

Förster E (2021) Reelin restricts dendritic growth of interneurons in the neocortex. Development
148.

Hiesberger T, Trommsdorff M, Howell B, Goffinet AM, Mumby MC, Cooper JA, Herz J (1999) Direct

Binding of Reelin to VLDL Receptor and ApoE Receptor 2 Induces Tyrosine Phosphorylation of
Disabled-1 and Modulates Tau Phosphorylation. Neuron 24:481-489.

Hong SE, Shugart YY, Huang DT, Shahwan SA, Grant PE, Hourihane JO, Martin NDT, Walsh CA (2000)

Autosomal recessive lissencephaly with cerebellar hypoplasia is associated with human RELN
mutations. Nature Genetics 26:93-96.

Howell BW, Herrick TM, Cooper JA (1999) Reelin-induced tryosine phosphorylation of Disabled 1 during

neuronal positioning. Genes & Development 13:643-648.

Howell BW, Herrick TM, Hildebrand JD, Zhang Y, Cooper JA (2000) Dab1 tyrosine phosphorylation sites

relay positional signals during mouse brain development. Curr Biol 10:877-885.

Hu H, Juvekar A, Lyssiotis CA, Lien EC, Albeck JG, Oh D, Varma G, Hung YP, Ullas S, Lauring J, Seth

P, Lundquist MR, Tolan DR, Grant AK, Needleman DJ, Asara JM, Cantley LC, Wulf GM (2016)
Phosphoinositide 3-Kinase Regulates Glycolysis through Mobilization of Aldolase from the Actin
Cytoskeleton. Cell 164:433-446.

Impagnatiello F, Guidotti AR, Pesold C, Dwivedi Y, Caruncho HJ, Pisu MG, Uzunov D, Smalheiser NP,

Davis JM, Pandey G, Pappas GD, Teuting P, Sharma RP, Costa E (1998) A decrease of reelin
expression ass a putative vulnerability factor in schizophrenia. Proceedings of the National
Academy of Sciences of the United States of America 95:15718-15723.

Jewett TJ, Sibley D (2003) Aldolase Forms a Bridge between Cell Surface Adhesins and the Actin

Cytoskeleton in Apicomplexan Parasites. Molecular Cell 11:885-894.

Jossin Y (2020) Reelin Functions, Mechanisms of Action and Signaling Pathways During Brain

Development and Maturation. Biomolecules 10.

Jossin Y, Goffinet AM (2007) Reelin signals through phosphatidylinositol 3-kinase and Akt to control

cortical development and through mTor to regulate dendritic growth. Molecular and Cellular
Biology 27:7113-7124.

Kohno T, Ishii K, Hirota Y, Honda T, Makino M, Kawasaki T, Nakajima K, Hattori M (2020) Reelin-Nrp1

Interaction Regulates Neocortical Dendrite Development in a Context-Specific Manner. The
Journal of Neuroscience 40:8248-8261.

Kohno T, Honda T, Kubo K, Nakano Y, Tsuchiya A, Murakami T, Banno H, Nakajima K, Hattori M (2015)

Importance of Reelin C-terminal region in the development and maintenance of the postnatal
cerebral cortex and its regulation by specific proteolysis. The Journal of Neuroscience 35:4776-
4787.

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Korotkevich G, Sukhov V, Budin N, Shpak B, Artyomov MN, Sergushichev A (2021) bioRxiv.

Kupferman JV, Basu J, Russo MJ, Guevarra J, Cheung SK, Siegelbaum SA (2014) Reelin signaling

specifies the molecular identity of the pyramidal neuron distal dendritic compartment. Cell
158:1335-1347.

Kusakabe T, Motoki K, Hori K (1997) Mode of Interactions of Human Aldolase Isozymes with

Cytoskeletons1. Archives of Biochemistry and Biophysics 344:184-193.

Lebherz HG, Rutter WJ (1969) Distribution of fructose diphosphate aldolase variants in biological systems.

Biochemistry 8:109-121.

Lee GH, Chhangawala Z, Daake SV, Savas JN, Yates JR, Comoletti D, D'Arcangello G (2014) Reelin

Induces Erk1/2 Signaling in Cortical Neurons Through a Non-canonical Pathway. The Journal of
Biological Chemistry 289:20307-20317.

Leemhuis J, Bouche E, Frotscher M, Henle F, Hein L, Herz J, Meyer DK, Pichler M, Roth G, Schwan C,

Bock HH (2010) Reelin signals through apolipoprotein E receptor 2 and Cdc42 to increase growth
cone motility and filopodia formation. The Journal of Neuroscience 30:14759-14772.

Matsuki T, Pramatarova A, Howell BW (2008) Reduction of Crk and CrkL expression blocks reelin-

induced dendritogenesis. J Cell Sci 121:1869-1875.

Meijering E, Jacob M, Sarria JCF, Steiner P, Hirling H, Unser M (2004) Design and Validation of a Tool

for Neurite Tracing and Analysis in Fluorescence Microscopy Images. Cytometry 58A:167-176.

Nichols AJ, Olson EC (2010) Reelin promotes neuronal orientation and dendritogenesis during preplate

splitting. Cereb Cortex 20:2213-2223.

Niu S, Yabut O, D'Arcangelo G (2008) The Reelin signaling pathway promotes dendritic spine

development in hippocampal neurons. The Journal of Neuroscience 28:10339-10348.

Niu S, Renfro A, Quattrocchi CC, Sheldon M, D'Arcangelo G (2004) Reelin promotes hippocampal

dendrite development through the VLDLR/ApoER2-Dab1 pathway. Neuron 41:71-84.

O'Dell RS, Cameron DA, Zipfel WR, Olson EC (2015) Reelin Prevents Apical Neurite Retraction during

Terminal Translocation and Dendrite Initiation. J Neurosci 35:10659-10674.

Pappas GD, Kriho V, Pesold C (2001) Reelin in the extracellular matrix and dendritic spines of the cortex

and hippocampus: a comparison between wild type and heterozygous reeler mice by
immunoelectron microscopy. J Neurocytol 30:413-425.

Penhoet EE, Kochman M, Rutter WJ (1969) Ioslation of fructose diphosphate aldolases A, B, and C.

Biochemistry 8:4391-4395.

Perisco AM et al. (2001) Reelin gene alleles and haplotypes as a factor predisposing to autistic disorder.

Molecular Psychiatry 6:150-159.

Pinto-Lord MC, Evrard P, Caviness VS, Jr. (1982) Obstructed neuronal migration along radial glial fibers

in the neocortex of the reeler mouse: a Golgi-EM analysis. Brain Res 256:379-393.

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Pinto Lord MC, Caviness VS, Jr. (1979) Determinants of cell shape and orientation: a comparative Golgi

analysis of cell-axon interrelationships in the developing neocortex of normal and reeler mice. J
Comp Neurol 187:49-69.

Rice DS, Sheldon M, D'Arcangello G, Nakajima K, Goldowitz D, Curran T (1998) Disabled-1 acts

downstream of Reelin in a signaling pathway that controls laminar organization in the mammalian
brain. Development 125:3719-3729.

Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK (2015) limma powers differential

expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43:e47.

Ritterson Lew C, Tolan DR (2012) Targeting of several glycolytic enzymes using RNA interference reveals

aldolase affects cancer cell proliferation through a non-glycolytic mechanism. The Journal of
Biological Chemistry 287:42554-42563.

Ritterson Lew C, Tolan DR (2013) Aldolase sequesters WASP and affects WASP/Arp2/3-stimulated actin

dynamics. The Journal of Cellular Biochemistry 114:1928-1939.

Rogers JT, Rusiana I, Trotter J, Zhao L, Donaldson E, Pak DT, Babus LW, Peters M, Banko JL, Chavis P,

Rebeck GW, Hoe HS, Weeber EJ (2011) Reelin supplementation enhances cognitive ability,
synaptic plasticity, and dendritic spine density. Learning & Memory 18:558-564.

Sun J, He D, Fu Y, Zhang R, Guo H, Wang Z, Wang Y, Gao T, Wei Y, Guo Y, Pang Q, Liu Q (2021) A

novel lncRNA ARST represses glioma progression by inhibiting ALDOA-mediated actin
cytoskeleton integrity. The Journal of Experimental & Clinical Cancer Research 40:187.

Tissir F, Goffinet AM (2003) Reelin and brain development. Nat Rev Neurosci 4:496-505.

Tochio T, Tanaka H, Nakata S, Hosoya H (2010) Fructose-1,6-bisphosphate aldolase A is involved in

HaCaT cell migration by inducing lamellipodia formation. The Journal of Dermatological Science
58:123-129.

Trommsdorff M, Gotthardt M, Stockinger W, Nimpf J, Hammer RE, Richardson JA, Herz J (1999)

Reeler/Disabled-like Disruption of Neuronal Migration in Knockout Mice Lacking the VLDL
Receptor and ApoE Receptor 2. Cell 97:689-701.

Wang J, Morris AJ, Tolan DR, Pagliaro L (1996) The Molecular Nature of the F-actin Binding Activity of

Aldolase Revealed with Site-directed Mutants. The Journal of Biological Chemistry 271:6861-
6865.

Weber CS (1965) FRUCTOSE DIPHOSPHATE ALDOLASE HOMOLOGS IN EMBRYOLOGICAL

DEVELOPMENT. In: Chemistry, p 198: University of Illinois.

Weeber EJ, Beffert U, Jones C, Christian JM, Forster E, Sweatt JD, Herz J (2002) Reelin and ApoE

receptors cooperate to enhance hippocampal synaptic plasticity and learning. The Journal of
Biological Chemistry 277:39944-39952.

Willnow TE, Rohlmann A, Horton J, Otani H, Braun JR, Hammer RE, Herz J (1996) RAP, a specialized

chaperone, prevents ligand-induced ER retention and degradation of LDL receptor-related
endocytic receptors. The EMBO Journal 15:2632-2639.

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

1 2 3 4 5 6

- + +

+ + -

- + - + - +

Reelin
rapamycin
LY294002

AKT

S473

AKT

total

S6K1

T389

S6K1

total

GAPDH

1 2 3 4 5 6

- + +

+ + -

- + - + - +

Reelin
rapamycin
LY294002

AKT

S473

AKT

total

S6K1

T389

S6K1

total

GAPDH

1 2 3 4 5 6

- + +

+ + -

- + - + - +

Reelin
rapamycin
LY294002

AKT

S473

AKT

total

S6K1

T389

S6K1

total

GAPDH

DIV 3

DIV 7

DIV 14

0.0

0.5

1.0

1.5

2.0

2.5

- - - - + +

- - + + - -

- + - + - +

Reelin
rapamycin
LY294002

- - - - + +

- - + + - -

- + - + - +

Reelin
rapamycin
LY294002

0.0

0.5

1.0

1.5

2.0

0.0

0.5

1.0

1.5

2.0

- - - - + +

- - + + - -

- + - + - +

Reelin
rapamycin
LY294002

- - - - + +

- - + + - -

- + - + - +

Reelin
rapamycin
LY294002

0.0

0.5

1.0

1.5

2.0

- - - - + +

- - + + - -

- + - + - +

Reelin
rapamycin
LY294002

0.0

0.5

1.0

1.5

2.0

- - - - + +

- - + + - -

- + - + - +

Reelin
rapamycin
LY294002

Reelin

pTyr
Dab1
Dab1
GAPDH

Input

Reelin

pTyr
Dab1
Dab1
GAPDH

Input

Reelin

pTyr
Dab1
Dab1
GAPDH

Input

DIV 3

DIV 7

DIV 14

Figure 1

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Figure 2

mock

Reelin

RAP

Reelin+RAP

-3

-2

-1

z-score

regulation of cytoskeleton organization

regulation of cell projection organization

regulation of protein localization

regulation of dendrite development

protein transport

RNA processing

neuron projection development

neuron development

positive regulation of gene expression

actin filament-based process

glycoprotein metabolic process

glycosyl compound metabolic process

eye morphogenesis

chloride transmembrane transport

transcription initiation at RNA polymerase II promoter

positive regulation of adaptive immune response

regulation of lymphocyte apoptotic process

camera-type eye morphogenesis

cytokine production

glycosphingolipid metabolic process

-2 -1 0 1 2

Reelin vs. Reelin+RAP (FDR<0.05)

UP
DOWN

NES

regulation of cytoskeleton organization

regulation of protein localization

regulation of dendrite development

regulation of anatomical structure morphogenesis

regulatulation of cell development

actin cytoskeleton organization

actin filament-based process

protein transport

cell morphogenesis

neuron projection development

transmembrane transport

cytochrome complex assembly

regulation of membrane lipid distribution

chloride transport

glycosphingolipid metabolic process

retina morphogenesis in camera-type eye

chloride transmembrane transport

glycosaminoglycan metabolic process

aminoglycan metabolic process

intraciliary transport

Reelin vs. mock (FDR<0.05)

-2 -1 0

1 2

NES

UP
DOWN

translation

regulation of protein localization

regulation of cytoskeleton development

actin filament-based process

mRNA metabolic process

ribonuceloprotein complex biogenesis

regulation of neuron projection development

membrane organization

regulation of cell projection organization

protein transport

pattern specification process

proteoglycan metabolic process

mitochondrial cytochrome c oxidase assembly

neural crest cell migration

appendage morphogenesis

limb morphogenesis

negative chemotaxis

limb development

appendage development

respiratory chain complex IV assembly

Reelin+RAP vs. RAP (FDR<0.05)

-2

-1

NES

UP
DOWN

Pathway

Gene ranks

NES

regulation of anatomical structure morphogenesis

actin filament-based process

regulation of dendrite development

2000

4000

6000

1.85

1.65

1.82

-value

-adjusted

1.2 10

-4

1.2 10

-4

1.4 10

-4

1.9 10

-3

2.0 10

-3

2.0 10

-3

Reelin vs. mock

Total Reelin Signaling

Canonical Reelin Signaling

Non-canonical Reelin Signaling

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Figure 3

0.0

0.5

1.0

1.5

2.0

2.5

mock control
Reelin
Reelin + RAP
Reelin + LY294002

llo

all neurites

lin

0.0

0.5

1.0

1.5

2.0

2.5

llo

primary neurites

llo

secondary neurites

-a

nsi

all neurites

primary neurites

secondary neurites

-a

nsi

-a

nsi

lin

all neurites

primary neurites

secondary neurites

ock

0.0

0.5

1.0

1.5

2.0

2.5

mock control
Reelin
Reelin + RAP
Reelin + LY294002

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

1 2 3 4 5 6

+ +

Reelin

p-cofilin

cofilin

total

-actin

DIV 7

fil

/co

fil

(

Figure 4

ili

all neurites

primary neurites

secondary neurites

lin

ili

0.0

0.5

1.0

1.5

2.0

2.5

mock control
Reelin
Reelin + RAP
Reelin + LY294002

0.0

0.5

1.0

1.5

0.0

0.5

1.0

1.5

2.0

l c

ili

(

mock control
Reelin

0.0

0.5

1.0

1.5

2.0

-a

(

)

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Reelin

LY294002

-actin

9 10 11 12

+ +

digitonin

RAP

aldolase A

lysate

0.0

0.5

1.0

1.5

2.0

2.5

-
-

Reelin
RAP
LY294002

lysa

-
-

Reelin

-actin

RAP

aldolase A

0.0

0.5

1.0

1.5

2.0

-
-

Reelin
RAP
LY294002

-a

Figure 5

LY294002

aldolase A

-
-

Reelin

-actin

aldolase A

Anisomycin

0.0

0.5

1.0

1.5

2.0

2.5

Reelin
Anisomycin

-a

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

Aldolase A

-actin

0.0

0.5

1.0

1.5

ssi

ize

scr

0.0

0.5

1.0

1.5

-a

ssi

ize

scr

Reelin

Control

scr

Distance from soma ( m)

10 20 30 40 50 60 70 80 90 10

scr

shRNA

Aldoa

shRNA

scr

shRNA + Reelin

Aldoa

shRNA + Reelin

rse

200

400

600

ite

(

)

. n

rit

(

)

100

150

200

rit

(

)

Reelin

Aldolase C

Figure 6

ssi

ize

scr

0.0

0.5

1.0

1.5

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

scr

shRNA

Aldoa

shRNA

GFP

Satb2

100

150

% of cells

scr

shRNA

Aldoa

shRNA

II/III

V/VI

200 400 600 800

Depth from pia ( m)

scr

shRNA

Aldoa

shRNA

scr

shRNA

Adoa

shRNA

rse

Distance from soma ( m)

0 10 20 30 40 50 60 70 80 90

500

1000

1500

2000

scr

shRNA

Aldoa

shRNA

ite

(

)

100

200

300

rit

(

)

100

200

300

ica

l d

ite

(

)

0-30 30-60 60-90

(

f ce

lls)

degree (

)

scr

shRNA

Aldoa

shRNA

Figure 7

II/III

100

150

0.0

0.5

1.0

1.5

. n

rit

(

)

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

rse

scr

shRNA

Aldoa

shRNA

Aldoa

R42A

Aldoa

D33S

Distance from soma ( m)

10 20 30 40 50 60 70 80 90 10

. n

rit

(

)

Aldoa

shRNA

200

400

600

800

ite

(

)

Aldoa

shRNA

100

150

Aldoa

shRNA

rit

(

)

scr

shRNA

Aldoa

shRNA

Aldoa

shRNA

Aldoa

D33S

Aldoa

R42A

Figure 8

The copyright holder for this preprint

this version posted January 12, 2024.

bioRxiv preprint

l l

ysa

t w

flo

-th

GST-RAP purification

RAP

Reelin

GST-RAP

pTyr

Dab1

GAPDH

Input

Supplementary Figure 2

The copyright holder for this preprint

this version posted January 12, 2024.